Incidental Mutation 'R3828:Commd9'
ID273835
Institutional Source Beutler Lab
Gene Symbol Commd9
Ensembl Gene ENSMUSG00000027163
Gene NameCOMM domain containing 9
Synonyms1810029F08Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101886247-101901646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101897141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000028584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028584]
Predicted Effect probably benign
Transcript: ENSMUST00000028584
AA Change: N93K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028584
Gene: ENSMUSG00000027163
AA Change: N93K

DomainStartEndE-ValueType
Pfam:HCaRG 15 194 9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156799
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, neural tube edema, and cardiovascular abnormalities including hemorrhages, heart hypoplasia, focal myocardial wall necrosis and narrowing of the dorsal aortas, and alterations in cranial blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Commd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Commd9 APN 2 101895156 nonsense probably null
IGL02232:Commd9 APN 2 101900979 missense probably benign 0.34
IGL03109:Commd9 APN 2 101897170 missense probably benign
R1873:Commd9 UTSW 2 101897157 missense probably benign 0.09
R1933:Commd9 UTSW 2 101901031 missense probably damaging 1.00
R3826:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3829:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3968:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3969:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3970:Commd9 UTSW 2 101897141 missense probably benign 0.18
R4059:Commd9 UTSW 2 101895154 missense possibly damaging 0.93
R4795:Commd9 UTSW 2 101898896 missense probably benign 0.00
R5289:Commd9 UTSW 2 101898894 missense probably benign 0.00
R5426:Commd9 UTSW 2 101898875 missense probably damaging 1.00
R5437:Commd9 UTSW 2 101901028 missense probably damaging 1.00
R7209:Commd9 UTSW 2 101895138 missense possibly damaging 0.94
R7425:Commd9 UTSW 2 101899900 nonsense probably null
R7552:Commd9 UTSW 2 101901065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTGTACAGAGCTCCAC -3'
(R):5'- ATGAACAGCTTTCCATTAAGGC -3'

Sequencing Primer
(F):5'- TGTACAGAGCTCCACCCCTG -3'
(R):5'- CCATTAAGGCAATTAAGCTCTGGGTG -3'
Posted On2015-04-02