Mutagenetix > Incidental Mutation

Incidental Mutation 'R3828:Rsph6a'

273840

Institutional Source

Beutler Lab

Gene Symbol

Rsph6a

Ensembl Gene

ENSMUSG00000040866

Gene Name

radial spoke head 6 homolog A (Chlamydomonas)

Synonyms

RSP4, Rshl1

MMRRC Submission

040886-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R3828 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19054690-19074447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19057614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 236 (L236P)

Ref Sequence

ENSEMBL: ENSMUSP00000046526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887]

AlphaFold

Q8CDR2

Predicted Effect

probably benign
Transcript: ENSMUST00000023882

SMART Domains

Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118

Domain	Start	End	E-Value	Type
low complexity region	106	118	N/A	INTRINSIC
Pfam:DUF3453	119	352	1.1e-63	PFAM
low complexity region	473	485	N/A	INTRINSIC
Pfam:Symplekin_C	887	1068	4.3e-78	PFAM
low complexity region	1123	1149	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000035521
AA Change: L236P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: L236P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Pfam:Radial_spoke	191	685	2.3e-200	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000076887
AA Change: L236P

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866
AA Change: L236P

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Pfam:Radial_spoke	188	287	3e-18	PFAM
Pfam:Radial_spoke	285	433	4.6e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130328

SMART Domains

Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

Domain	Start	End	E-Value	Type
Pfam:Symplekin_C	1	92	3.9e-44	PFAM
low complexity region	125	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148861

Meta Mutation Damage Score

0.5413

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Camk2b	A	G	11: 6,028,932	V32A	probably damaging	Het
Cbr2	A	T	11: 120,730,452	H140Q	probably benign	Het
Cdk19	T	C	10: 40,475,613	V258A	probably damaging	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Cx3cl1	A	T	8: 94,777,306		probably benign	Het
Cxcr6	A	T	9: 123,810,869	M319L	probably benign	Het
Dlg5	T	A	14: 24,146,158	K1308I	probably damaging	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
Ffar2	A	T	7: 30,820,085	I10N	possibly damaging	Het
Gm17521	C	A	X: 123,029,225	G149C	unknown	Het
Gm5862	T	G	5: 26,019,347	H208P	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Ino80d	A	T	1: 63,062,078	M463K	possibly damaging	Het
Lrp2	G	A	2: 69,426,012	P4595S	probably benign	Het
Mark4	A	G	7: 19,443,187	I239T	possibly damaging	Het
Mcoln1	C	T	8: 3,500,601	A2V	possibly damaging	Het
Mcts1	T	C	X: 38,602,568		probably benign	Het
Mrgprb5	T	A	7: 48,168,091	M299L	probably benign	Het
Ncapg2	A	T	12: 116,407,318		probably benign	Het
Olfr679	A	G	7: 105,086,297	N194D	probably benign	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Rtkn2	A	T	10: 67,997,626		probably null	Het
Stk11	T	C	10: 80,127,948		probably null	Het
Syt14	T	C	1: 192,901,775	N444S	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tnks	A	G	8: 34,873,178	F429L	probably damaging	Het
Usp15	T	A	10: 123,196,870	I16F	possibly damaging	Het
Vps50	T	C	6: 3,533,500	I244T	probably benign	Het

Other mutations in Rsph6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Rsph6a	APN	7	19054868	nonsense	probably null
IGL01656:Rsph6a	APN	7	19054845	missense	probably benign	0.00
IGL02997:Rsph6a	APN	7	19054839	missense	probably benign	0.32
R0396:Rsph6a	UTSW	7	19074106	missense	probably damaging	1.00
R0467:Rsph6a	UTSW	7	19057669	missense	possibly damaging	0.95
R0545:Rsph6a	UTSW	7	19054946	nonsense	probably null
R0603:Rsph6a	UTSW	7	19065961	missense	possibly damaging	0.66
R0848:Rsph6a	UTSW	7	19057670	missense	probably benign	0.07
R1943:Rsph6a	UTSW	7	19074076	missense	probably damaging	1.00
R2133:Rsph6a	UTSW	7	19068106	missense	probably damaging	1.00
R3713:Rsph6a	UTSW	7	19057550	missense	probably damaging	0.98
R3762:Rsph6a	UTSW	7	19055331	missense	probably damaging	1.00
R3826:Rsph6a	UTSW	7	19057614	missense	probably damaging	1.00
R3827:Rsph6a	UTSW	7	19057614	missense	probably damaging	1.00
R4355:Rsph6a	UTSW	7	19067078	splice site	probably null
R4429:Rsph6a	UTSW	7	19074063	missense	probably damaging	1.00
R4524:Rsph6a	UTSW	7	19066045	missense	probably damaging	1.00
R4799:Rsph6a	UTSW	7	19065858	nonsense	probably null
R4896:Rsph6a	UTSW	7	19057740	missense	possibly damaging	0.67
R4906:Rsph6a	UTSW	7	19068072	missense	possibly damaging	0.92
R5004:Rsph6a	UTSW	7	19057740	missense	possibly damaging	0.67
R5637:Rsph6a	UTSW	7	19054895	missense	probably benign
R6066:Rsph6a	UTSW	7	19065815	missense	probably damaging	1.00
R7013:Rsph6a	UTSW	7	19054895	missense	probably benign
R7193:Rsph6a	UTSW	7	19065647	missense	probably damaging	1.00
R7689:Rsph6a	UTSW	7	19068037	missense	possibly damaging	0.64
R8170:Rsph6a	UTSW	7	19057580	missense	probably damaging	1.00
R8177:Rsph6a	UTSW	7	19074239	missense	unknown
R8956:Rsph6a	UTSW	7	19065439	intron	probably benign
R9032:Rsph6a	UTSW	7	19065325	missense	probably damaging	1.00
R9085:Rsph6a	UTSW	7	19065325	missense	probably damaging	1.00
R9222:Rsph6a	UTSW	7	19068061	missense	possibly damaging	0.88
R9529:Rsph6a	UTSW	7	19065610	missense	probably benign	0.15
R9654:Rsph6a	UTSW	7	19065407	missense	probably damaging	0.99
R9672:Rsph6a	UTSW	7	19065917	missense	probably damaging	1.00
Z1177:Rsph6a	UTSW	7	19065931	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGTGTGTCCCTAGCACTAG -3'
(R):5'- GCTGTTCACACCTTAGCACTG -3'

Sequencing Primer
(F):5'- CTGTGTGTCCCTAGCACTAGAAAAAG -3'
(R):5'- CACTGGCTTTGGCATAGGC -3'

Posted On

2015-04-02