Incidental Mutation 'R3828:Rsph6a'
ID273840
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Nameradial spoke head 6 homolog A (Chlamydomonas)
SynonymsRSP4, Rshl1
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19054690-19074447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19057614 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 236 (L236P)
Ref Sequence ENSEMBL: ENSMUSP00000046526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035521
AA Change: L236P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: L236P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
AA Change: L236P

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866
AA Change: L236P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130328
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148861
Meta Mutation Damage Score 0.5413 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 19054868 nonsense probably null
IGL01656:Rsph6a APN 7 19054845 missense probably benign 0.00
IGL02997:Rsph6a APN 7 19054839 missense probably benign 0.32
R0396:Rsph6a UTSW 7 19074106 missense probably damaging 1.00
R0467:Rsph6a UTSW 7 19057669 missense possibly damaging 0.95
R0545:Rsph6a UTSW 7 19054946 nonsense probably null
R0603:Rsph6a UTSW 7 19065961 missense possibly damaging 0.66
R0848:Rsph6a UTSW 7 19057670 missense probably benign 0.07
R1943:Rsph6a UTSW 7 19074076 missense probably damaging 1.00
R2133:Rsph6a UTSW 7 19068106 missense probably damaging 1.00
R3713:Rsph6a UTSW 7 19057550 missense probably damaging 0.98
R3762:Rsph6a UTSW 7 19055331 missense probably damaging 1.00
R3826:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3827:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R4355:Rsph6a UTSW 7 19067078 splice site probably null
R4429:Rsph6a UTSW 7 19074063 missense probably damaging 1.00
R4524:Rsph6a UTSW 7 19066045 missense probably damaging 1.00
R4799:Rsph6a UTSW 7 19065858 nonsense probably null
R4896:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 19068072 missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 19054895 missense probably benign
R6066:Rsph6a UTSW 7 19065815 missense probably damaging 1.00
R7013:Rsph6a UTSW 7 19054895 missense probably benign
R7193:Rsph6a UTSW 7 19065647 missense probably damaging 1.00
R7689:Rsph6a UTSW 7 19068037 missense possibly damaging 0.64
R8170:Rsph6a UTSW 7 19057580 missense probably damaging 1.00
R8177:Rsph6a UTSW 7 19074239 missense unknown
Z1177:Rsph6a UTSW 7 19065931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTGTGTCCCTAGCACTAG -3'
(R):5'- GCTGTTCACACCTTAGCACTG -3'

Sequencing Primer
(F):5'- CTGTGTGTCCCTAGCACTAGAAAAAG -3'
(R):5'- CACTGGCTTTGGCATAGGC -3'
Posted On2015-04-02