Incidental Mutation 'R3828:Mark4'
ID 273841
Institutional Source Beutler Lab
Gene Symbol Mark4
Ensembl Gene ENSMUSG00000030397
Gene Name MAP/microtubule affinity regulating kinase 4
Synonyms Markl1, 2410090P21Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3828 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19424775-19458821 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19443187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 239 (I239T)
Ref Sequence ENSEMBL: ENSMUSP00000082862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085715] [ENSMUST00000209058]
AlphaFold Q8CIP4
Predicted Effect possibly damaging
Transcript: ENSMUST00000085715
AA Change: I239T

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: I239T

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209011
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Meta Mutation Damage Score 0.6733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Mark4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mark4 APN 7 19431824 missense possibly damaging 0.50
IGL02321:Mark4 APN 7 19426389 missense probably benign
IGL02813:Mark4 APN 7 19447256 splice site probably null
IGL03088:Mark4 APN 7 19451584 missense probably damaging 1.00
breakfast UTSW 7 19443226 missense probably damaging 1.00
R3828_Mark4_841 UTSW 7 19443187 missense possibly damaging 0.65
Towncar UTSW 7 19447243 missense possibly damaging 0.95
R0555:Mark4 UTSW 7 19448673 splice site probably benign
R1278:Mark4 UTSW 7 19431770 missense probably damaging 0.99
R1385:Mark4 UTSW 7 19426027 splice site probably null
R3415:Mark4 UTSW 7 19451725 missense probably benign 0.00
R4281:Mark4 UTSW 7 19433446 missense probably benign 0.09
R4682:Mark4 UTSW 7 19445172 splice site probably null
R4791:Mark4 UTSW 7 19451657 missense probably benign 0.19
R5184:Mark4 UTSW 7 19447243 missense possibly damaging 0.95
R5319:Mark4 UTSW 7 19436961 missense possibly damaging 0.95
R5330:Mark4 UTSW 7 19436983 missense probably damaging 1.00
R5488:Mark4 UTSW 7 19429607 splice site probably null
R5811:Mark4 UTSW 7 19448639 missense probably damaging 1.00
R6058:Mark4 UTSW 7 19426385 missense probably benign 0.10
R6148:Mark4 UTSW 7 19429516 missense probably benign 0.00
R6333:Mark4 UTSW 7 19443283 missense probably damaging 0.98
R6698:Mark4 UTSW 7 19429437 missense probably benign 0.01
R7265:Mark4 UTSW 7 19451725 missense probably benign 0.00
R7429:Mark4 UTSW 7 19426167 missense probably damaging 0.99
R7664:Mark4 UTSW 7 19443226 missense probably damaging 1.00
R8027:Mark4 UTSW 7 19447239 missense possibly damaging 0.71
R9321:Mark4 UTSW 7 19436976 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCAGAGCAGGTCAATATTAGAGC -3'
(R):5'- AGGCTGAAAACCTGTTGCTG -3'

Sequencing Primer
(F):5'- CCAGCTGTTCAGCTCACAG -3'
(R):5'- AAAACCTGTTGCTGGATGCC -3'
Posted On 2015-04-02