Incidental Mutation 'R3828:Ffar2'
ID273842
Institutional Source Beutler Lab
Gene Symbol Ffar2
Ensembl Gene ENSMUSG00000051314
Gene Namefree fatty acid receptor 2
SynonymsGpr43
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30818348-30823775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30820085 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 10 (I10N)
Ref Sequence ENSEMBL: ENSMUSP00000140493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053156] [ENSMUST00000163504] [ENSMUST00000168528] [ENSMUST00000186059] [ENSMUST00000186339] [ENSMUST00000186534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053156
AA Change: I10N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052600
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.1e-8 PFAM
Pfam:7tm_1 24 273 1.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163504
AA Change: I10N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127758
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.2e-8 PFAM
Pfam:7tm_1 24 277 1.2e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168528
AA Change: I10N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129398
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 10 284 3.1e-8 PFAM
Pfam:7tm_1 24 273 1.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186059
AA Change: I10N

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140484
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7tm_1 24 133 1.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186339
AA Change: I10N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140493
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 8 175 1.9e-4 PFAM
Pfam:7tm_1 24 179 1.4e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186534
AA Change: I10N

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140215
Gene: ENSMUSG00000051314
AA Change: I10N

DomainStartEndE-ValueType
Pfam:7tm_1 24 142 1.5e-22 PFAM
Meta Mutation Damage Score 0.2356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for short chain free fatty acids and may be involved in the inflammatory response and in regulating lipid plasma levels. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a null allele show altered granulocyte and neutrophil physiology and increased inflammation in models of induced colitis, arthritis and asthma, whereas homozygotes for a different null allele show reduced neutrophil recruitment and decreased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Ffar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Ffar2 APN 7 30819176 missense probably benign 0.00
IGL01655:Ffar2 APN 7 30819587 missense probably damaging 1.00
R1874:Ffar2 UTSW 7 30819414 splice site probably null
R3826:Ffar2 UTSW 7 30820085 missense possibly damaging 0.77
R3827:Ffar2 UTSW 7 30820085 missense possibly damaging 0.77
R4156:Ffar2 UTSW 7 30819668 missense probably damaging 1.00
R6377:Ffar2 UTSW 7 30819546 missense probably benign 0.00
R6987:Ffar2 UTSW 7 30819683 missense possibly damaging 0.94
R7270:Ffar2 UTSW 7 30819504 missense probably benign 0.00
R7374:Ffar2 UTSW 7 30820040 missense probably damaging 1.00
R7616:Ffar2 UTSW 7 30819932 missense probably damaging 1.00
R7784:Ffar2 UTSW 7 30819258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGTTGGATGCTGCTTCCAC -3'
(R):5'- GCTAAGTCAATAATTGCTCTGGGC -3'

Sequencing Primer
(F):5'- GGATGCTGCTTCCACGATCC -3'
(R):5'- CTCTGGGCAGTTCTGGCAG -3'
Posted On2015-04-02