Incidental Mutation 'R3828:Mrgprb5'
ID273843
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48168091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 299 (M299L)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably benign
Transcript: ENSMUST00000094389
AA Change: M299L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: M299L

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGTTTCTGTGTAACAAGCCC -3'
(R):5'- ATTGCTCTCACATTGGTGGTC -3'

Sequencing Primer
(F):5'- AGTTTCTGTGTAACAAGCCCCTTTC -3'
(R):5'- CACATTGGTGGTCTTCATATTCTTG -3'
Posted On2015-04-02