Incidental Mutation 'R3828:Chd2'
ID273844
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 040886-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73491415 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 577 (Y577H)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169922
AA Change: Y577H

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: Y577H

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 splice site probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 splice site probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
R7500:Chd2 UTSW 7 73451808 missense probably damaging 1.00
R7615:Chd2 UTSW 7 73441642 missense probably damaging 0.97
R7646:Chd2 UTSW 7 73435773 missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73471819 missense probably null 1.00
R7898:Chd2 UTSW 7 73519475 critical splice donor site probably null
R7935:Chd2 UTSW 7 73499625 missense probably benign 0.01
R8033:Chd2 UTSW 7 73435880 missense probably damaging 1.00
R8070:Chd2 UTSW 7 73451758 missense probably benign
R8071:Chd2 UTSW 7 73537384 missense probably benign
R8188:Chd2 UTSW 7 73429756 nonsense probably null
R8196:Chd2 UTSW 7 73468537 missense probably benign 0.00
R8258:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8259:Chd2 UTSW 7 73435784 missense probably benign 0.11
R8357:Chd2 UTSW 7 73447237 missense probably damaging 0.99
R8457:Chd2 UTSW 7 73447237 missense probably damaging 0.99
RF009:Chd2 UTSW 7 73519662 missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Z1177:Chd2 UTSW 7 73468586 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TAAGCTCCCATACGGTGAGG -3'
(R):5'- TCTAGCTTGGGTTACAGCAAG -3'

Sequencing Primer
(F):5'- GTTTCACCTTTTAAACGGAGCAAG -3'
(R):5'- CAGCAAGTCTTCTTAGAGTGCATAGG -3'
Posted On2015-04-02