Incidental Mutation 'R3828:Olfr679'
ID273845
Institutional Source Beutler Lab
Gene Symbol Olfr679
Ensembl Gene ENSMUSG00000096029
Gene Nameolfactory receptor 679
SynonymsMOR40-2, GA_x6K02T2PBJ9-7714499-7715446
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105081205-105090642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105086297 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 194 (N194D)
Ref Sequence ENSEMBL: ENSMUSP00000149116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042676] [ENSMUST00000098158] [ENSMUST00000214328] [ENSMUST00000215704]
Predicted Effect probably benign
Transcript: ENSMUST00000042676
Predicted Effect probably benign
Transcript: ENSMUST00000098158
AA Change: N194D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095761
Gene: ENSMUSG00000096029
AA Change: N194D

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.2e-10 PFAM
Pfam:7tm_1 45 296 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214328
AA Change: N194D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214738
Predicted Effect probably benign
Transcript: ENSMUST00000215704
AA Change: N194D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Olfr679
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Olfr679 APN 7 105086323 nonsense probably null
IGL02505:Olfr679 APN 7 105086333 missense probably benign
IGL03160:Olfr679 APN 7 105086313 missense probably damaging 1.00
R0079:Olfr679 UTSW 7 105085928 missense probably damaging 1.00
R2126:Olfr679 UTSW 7 105086615 missense probably damaging 1.00
R2185:Olfr679 UTSW 7 105086302 missense possibly damaging 0.79
R3122:Olfr679 UTSW 7 105086178 missense probably benign 0.00
R4235:Olfr679 UTSW 7 105085787 missense possibly damaging 0.71
R4360:Olfr679 UTSW 7 105086253 missense probably damaging 0.99
R4485:Olfr679 UTSW 7 105086601 missense probably damaging 1.00
R4790:Olfr679 UTSW 7 105086637 unclassified probably benign
R5542:Olfr679 UTSW 7 105086358 missense probably damaging 1.00
R5599:Olfr679 UTSW 7 105086550 splice site probably null
R5723:Olfr679 UTSW 7 105091102 missense probably damaging 0.99
R5770:Olfr679 UTSW 7 105090895 missense probably damaging 0.99
R5871:Olfr679 UTSW 7 105086304 missense possibly damaging 0.65
R7231:Olfr679 UTSW 7 105085787 missense possibly damaging 0.94
R7593:Olfr679 UTSW 7 105086165 missense probably benign
R7881:Olfr679 UTSW 7 105086573 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCACCCACTGAGATATCCATC -3'
(R):5'- TCCTCTTAGCTACATGTGTGAGG -3'

Sequencing Primer
(F):5'- CCATCATCACTGACCAATTTGTAG -3'
(R):5'- TAGCTACATGTGTGAGGATAAAAACC -3'
Posted On2015-04-02