Incidental Mutation 'R3828:Mcoln1'
ID273846
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Namemucolipin 1
SynonymsTRPML1, mucolipidin, 2210015I05Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3828 (G1)
Quality Score98.6
Status Validated
Chromosome8
Chromosomal Location3500457-3515232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3500601 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000146575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000061508] [ENSMUST00000160338] [ENSMUST00000207318] [ENSMUST00000208306] [ENSMUST00000208423]
AlphaFold Q99J21
Predicted Effect probably benign
Transcript: ENSMUST00000004683
AA Change: A2V

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: A2V

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061508
SMART Domains Protein: ENSMUSP00000060344
Gene: ENSMUSG00000047264

DomainStartEndE-ValueType
low complexity region 24 49 N/A INTRINSIC
ZnF_C2H2 154 176 1.47e-3 SMART
ZnF_C2H2 182 204 2.95e-3 SMART
ZnF_C2H2 210 232 1.67e-2 SMART
ZnF_C2H2 238 260 3.63e-3 SMART
ZnF_C2H2 266 288 2.4e-3 SMART
ZnF_C2H2 294 316 1.4e-4 SMART
ZnF_C2H2 322 344 4.01e-5 SMART
ZnF_C2H2 350 372 2.4e-3 SMART
ZnF_C2H2 378 400 1.84e-4 SMART
low complexity region 422 430 N/A INTRINSIC
low complexity region 447 473 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160338
AA Change: A2V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567
AA Change: A2V

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207318
Predicted Effect possibly damaging
Transcript: ENSMUST00000208306
AA Change: A2V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000208423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208739
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7936:Mcoln1 UTSW 8 3505924 missense probably damaging 1.00
R8058:Mcoln1 UTSW 8 3508378 missense probably benign
R8082:Mcoln1 UTSW 8 3507420 missense probably benign 0.01
R8093:Mcoln1 UTSW 8 3508740 missense possibly damaging 0.95
R9090:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAAAGGGTCGCGCTTGTC -3'
(R):5'- AGAACACTAAGCTGGACGC -3'

Sequencing Primer
(F):5'- CACGTGTTCAGTTCAGGCG -3'
(R):5'- ATTCTAGGATCGGTAGAAGCTCTCC -3'
Posted On2015-04-02