Incidental Mutation 'R3828:Cx3cl1'
ID273851
Institutional Source Beutler Lab
Gene Symbol Cx3cl1
Ensembl Gene ENSMUSG00000031778
Gene Namechemokine (C-X3-C motif) ligand 1
SynonymsD8Bwg0439e, neurotactin, fractalkine, CX3C, Scyd1
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94772009-94782427 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 94777306 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034230] [ENSMUST00000135970] [ENSMUST00000150307] [ENSMUST00000150307] [ENSMUST00000150307] [ENSMUST00000211947] [ENSMUST00000211956]
Predicted Effect probably benign
Transcript: ENSMUST00000034230
SMART Domains Protein: ENSMUSP00000034230
Gene: ENSMUSG00000031778

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCY 29 89 4.23e-17 SMART
low complexity region 132 143 N/A INTRINSIC
low complexity region 218 236 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135970
Predicted Effect probably benign
Transcript: ENSMUST00000150307
SMART Domains Protein: ENSMUSP00000123538
Gene: ENSMUSG00000031778

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150307
SMART Domains Protein: ENSMUSP00000123538
Gene: ENSMUSG00000031778

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150307
SMART Domains Protein: ENSMUSP00000123538
Gene: ENSMUSG00000031778

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151783
Predicted Effect probably benign
Transcript: ENSMUST00000211947
Predicted Effect probably benign
Transcript: ENSMUST00000211956
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in Gr1(low) monocyte levels, and increased neuronal cell loss in a neurotoxin (MPTP)-induced model of Parkinson disease. Mice homozygous for a different knock-out allele are less susceptible to cerebral ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Cx3cl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Cx3cl1 APN 8 94778073 missense probably damaging 0.99
IGL02044:Cx3cl1 APN 8 94780540 missense probably damaging 1.00
IGL02309:Cx3cl1 APN 8 94780032 missense probably benign
R1749:Cx3cl1 UTSW 8 94780161 splice site probably null
R1876:Cx3cl1 UTSW 8 94780420 missense probably damaging 1.00
R1905:Cx3cl1 UTSW 8 94780059 missense probably benign 0.03
R2131:Cx3cl1 UTSW 8 94779573 missense probably benign 0.03
R3547:Cx3cl1 UTSW 8 94778124 missense possibly damaging 0.66
R3826:Cx3cl1 UTSW 8 94777306 intron probably benign
R3827:Cx3cl1 UTSW 8 94777306 intron probably benign
R3829:Cx3cl1 UTSW 8 94777306 intron probably benign
R4461:Cx3cl1 UTSW 8 94780556 makesense probably null
R4705:Cx3cl1 UTSW 8 94780207 missense probably benign 0.32
R4998:Cx3cl1 UTSW 8 94780425 missense probably damaging 1.00
R5165:Cx3cl1 UTSW 8 94779876 missense probably benign 0.04
R7150:Cx3cl1 UTSW 8 94779963 missense probably damaging 1.00
R7726:Cx3cl1 UTSW 8 94780239 missense probably damaging 1.00
R8346:Cx3cl1 UTSW 8 94780540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGATAGGACACTCTGCTGG -3'
(R):5'- TCAAGGGCTCAGCAATCACC -3'

Sequencing Primer
(F):5'- TAGATCAGAGGTTCTCACCCATGG -3'
(R):5'- GCTCAGCAATCACCCTACACATG -3'
Posted On2015-04-02