Mutagenetix > Incidental Mutations

Incidental Mutation 'R3828:Cxcr6'

273852

Institutional Source

Beutler Lab

Gene Symbol

Cxcr6

Ensembl Gene

ENSMUSG00000048521

Gene Name

chemokine (C-X-C motif) receptor 6

Synonyms

STRL33, BONZO

MMRRC Submission

040886-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3828 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123806475-123811760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123810869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 319 (M319L)

Ref Sequence

ENSEMBL: ENSMUSP00000151182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]

AlphaFold

Q9EQ16

Predicted Effect

probably benign
Transcript: ENSMUST00000049810
AA Change: M312L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: M312L

Domain	Start	End	E-Value	Type
Pfam:7tm_1	57	297	5.2e-43	PFAM
low complexity region	324	334	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084715

SMART Domains

Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	19	167	4.7e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000167595

SMART Domains

Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	20	167	7.8e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000216072
AA Change: M319L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (34/34)

MGI Phenotype

PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Camk2b	A	G	11: 6,028,932	V32A	probably damaging	Het
Cbr2	A	T	11: 120,730,452	H140Q	probably benign	Het
Cdk19	T	C	10: 40,475,613	V258A	probably damaging	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Cx3cl1	A	T	8: 94,777,306		probably benign	Het
Dlg5	T	A	14: 24,146,158	K1308I	probably damaging	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
Ffar2	A	T	7: 30,820,085	I10N	possibly damaging	Het
Gm17521	C	A	X: 123,029,225	G149C	unknown	Het
Gm5862	T	G	5: 26,019,347	H208P	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Ino80d	A	T	1: 63,062,078	M463K	possibly damaging	Het
Lrp2	G	A	2: 69,426,012	P4595S	probably benign	Het
Mark4	A	G	7: 19,443,187	I239T	possibly damaging	Het
Mcoln1	C	T	8: 3,500,601	A2V	possibly damaging	Het
Mcts1	T	C	X: 38,602,568		probably benign	Het
Mrgprb5	T	A	7: 48,168,091	M299L	probably benign	Het
Ncapg2	A	T	12: 116,407,318		probably benign	Het
Olfr679	A	G	7: 105,086,297	N194D	probably benign	Het
Pcdhga4	G	T	18: 37,687,601	L734F	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Rsph6a	T	C	7: 19,057,614	L236P	probably damaging	Het
Rtkn2	A	T	10: 67,997,626		probably null	Het
Stk11	T	C	10: 80,127,948		probably null	Het
Syt14	T	C	1: 192,901,775	N444S	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tnks	A	G	8: 34,873,178	F429L	probably damaging	Het
Usp15	T	A	10: 123,196,870	I16F	possibly damaging	Het
Vps50	T	C	6: 3,533,500	I244T	probably benign	Het

Other mutations in Cxcr6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02313:Cxcr6	APN	9	123810705	missense	probably damaging	0.96
IGL03192:Cxcr6	APN	9	123810046	missense	possibly damaging	0.52
IGL03342:Cxcr6	APN	9	123810407	nonsense	probably null
PIT4362001:Cxcr6	UTSW	9	123810461	missense	probably benign	0.00
R0399:Cxcr6	UTSW	9	123810951	missense	possibly damaging	0.70
R0487:Cxcr6	UTSW	9	123810398	missense	probably benign	0.02
R1496:Cxcr6	UTSW	9	123810347	missense	probably benign	0.12
R1662:Cxcr6	UTSW	9	123810548	missense	possibly damaging	0.71
R1733:Cxcr6	UTSW	9	123810116	missense	probably damaging	1.00
R1869:Cxcr6	UTSW	9	123809957	missense	probably benign	0.37
R3055:Cxcr6	UTSW	9	123810464	missense	probably damaging	1.00
R3056:Cxcr6	UTSW	9	123810464	missense	probably damaging	1.00
R3771:Cxcr6	UTSW	9	123810485	missense	probably benign	0.02
R4810:Cxcr6	UTSW	9	123810162	missense	probably damaging	1.00
R5685:Cxcr6	UTSW	9	123810746	missense	probably benign	0.01
R5748:Cxcr6	UTSW	9	123810341	missense	probably damaging	1.00
R6210:Cxcr6	UTSW	9	123810008	missense	possibly damaging	0.95
R6612:Cxcr6	UTSW	9	123810720	missense	probably damaging	1.00
R6773:Cxcr6	UTSW	9	123810290	missense	possibly damaging	0.83
R7414:Cxcr6	UTSW	9	123810222	nonsense	probably null
R7427:Cxcr6	UTSW	9	123810240	missense	probably benign	0.41
R7428:Cxcr6	UTSW	9	123810240	missense	probably benign	0.41
R7863:Cxcr6	UTSW	9	123810849	missense	probably damaging	0.98
R8426:Cxcr6	UTSW	9	123810006	missense	probably benign	0.00
R8824:Cxcr6	UTSW	9	123810941	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGCTCGAAACTTCCAGAAGC -3'
(R):5'- AGCCATGCTCCTAGAATTCTG -3'

Sequencing Primer
(F):5'- AAGATCATCTTCCTTGTAGTGGC -3'
(R):5'- CTGTTATTAACTTCTCTAAGTGTGGC -3'

Posted On

2015-04-02