Incidental Mutation 'R3828:Cxcr6'
ID273852
Institutional Source Beutler Lab
Gene Symbol Cxcr6
Ensembl Gene ENSMUSG00000048521
Gene Namechemokine (C-X-C motif) receptor 6
SynonymsSTRL33, BONZO
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123806475-123811760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123810869 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 319 (M319L)
Ref Sequence ENSEMBL: ENSMUSP00000151182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]
Predicted Effect probably benign
Transcript: ENSMUST00000049810
AA Change: M312L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: M312L

DomainStartEndE-ValueType
Pfam:7tm_1 57 297 5.2e-43 PFAM
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000216072
AA Change: M319L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Cxcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Cxcr6 APN 9 123810705 missense probably damaging 0.96
IGL03192:Cxcr6 APN 9 123810046 missense possibly damaging 0.52
IGL03342:Cxcr6 APN 9 123810407 nonsense probably null
PIT4362001:Cxcr6 UTSW 9 123810461 missense probably benign 0.00
R0399:Cxcr6 UTSW 9 123810951 missense possibly damaging 0.70
R0487:Cxcr6 UTSW 9 123810398 missense probably benign 0.02
R1496:Cxcr6 UTSW 9 123810347 missense probably benign 0.12
R1662:Cxcr6 UTSW 9 123810548 missense possibly damaging 0.71
R1733:Cxcr6 UTSW 9 123810116 missense probably damaging 1.00
R1869:Cxcr6 UTSW 9 123809957 missense probably benign 0.37
R3055:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3056:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3771:Cxcr6 UTSW 9 123810485 missense probably benign 0.02
R4810:Cxcr6 UTSW 9 123810162 missense probably damaging 1.00
R5685:Cxcr6 UTSW 9 123810746 missense probably benign 0.01
R5748:Cxcr6 UTSW 9 123810341 missense probably damaging 1.00
R6210:Cxcr6 UTSW 9 123810008 missense possibly damaging 0.95
R6612:Cxcr6 UTSW 9 123810720 missense probably damaging 1.00
R6773:Cxcr6 UTSW 9 123810290 missense possibly damaging 0.83
R7414:Cxcr6 UTSW 9 123810222 nonsense probably null
R7427:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7428:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7863:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
R8426:Cxcr6 UTSW 9 123810006 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCGAAACTTCCAGAAGC -3'
(R):5'- AGCCATGCTCCTAGAATTCTG -3'

Sequencing Primer
(F):5'- AAGATCATCTTCCTTGTAGTGGC -3'
(R):5'- CTGTTATTAACTTCTCTAAGTGTGGC -3'
Posted On2015-04-02