Incidental Mutation 'R3828:Cdk19'
ID273853
Institutional Source Beutler Lab
Gene Symbol Cdk19
Ensembl Gene ENSMUSG00000038481
Gene Namecyclin-dependent kinase 19
SynonymsCdc2l6, 2700084L06Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score215
Status Validated
Chromosome10
Chromosomal Location40339564-40483818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40475613 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000093414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044672] [ENSMUST00000095743] [ENSMUST00000214659] [ENSMUST00000215000]
Predicted Effect probably damaging
Transcript: ENSMUST00000044672
AA Change: V302A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040936
Gene: ENSMUSG00000038481
AA Change: V302A

DomainStartEndE-ValueType
S_TKc 21 335 9.96e-83 SMART
low complexity region 371 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 467 499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095743
AA Change: V258A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093414
Gene: ENSMUSG00000038481
AA Change: V258A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 22 172 7.2e-17 PFAM
Pfam:Pkinase 23 166 2.5e-29 PFAM
Pfam:Pkinase 164 291 1.2e-11 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 423 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214659
Predicted Effect probably benign
Transcript: ENSMUST00000215000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216736
Meta Mutation Damage Score 0.3707 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of the components of the Mediator co-activator complex. The Mediator complex is a multi-protein complex required for transcriptional activation by DNA binding transcription factors of genes transcribed by RNA polymerase II. The protein encoded by this gene is similar to cyclin-dependent kinase 8 which can also be a component of the Mediator complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Cdk19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Cdk19 APN 10 40436165 missense probably benign 0.14
IGL00482:Cdk19 APN 10 40469648 missense possibly damaging 0.61
IGL03380:Cdk19 APN 10 40476912 missense probably benign 0.42
R0217:Cdk19 UTSW 10 40476258 splice site probably benign
R1639:Cdk19 UTSW 10 40476969 critical splice donor site probably null
R1899:Cdk19 UTSW 10 40479780 utr 3 prime probably benign
R2102:Cdk19 UTSW 10 40479730 utr 3 prime probably benign
R4124:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4125:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4128:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4474:Cdk19 UTSW 10 40469956 critical splice donor site probably null
R4668:Cdk19 UTSW 10 40466710 missense probably damaging 0.98
R4750:Cdk19 UTSW 10 40476199 missense probably damaging 1.00
R4871:Cdk19 UTSW 10 40476236 missense probably benign 0.03
R4993:Cdk19 UTSW 10 40476218 missense possibly damaging 0.79
R5078:Cdk19 UTSW 10 40436154 missense probably damaging 1.00
R7130:Cdk19 UTSW 10 40479765 missense unknown
R7570:Cdk19 UTSW 10 40477958 missense possibly damaging 0.80
R8179:Cdk19 UTSW 10 40394372 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTCAGCAGTGAGTAACGG -3'
(R):5'- TCCTGAAATTACCAATTAGGCCCC -3'

Sequencing Primer
(F):5'- AACGGTGAGTGAGTGTCTGCAC -3'
(R):5'- AGGCCCCTTAAAATTCTTTTCTGAC -3'
Posted On2015-04-02