Incidental Mutation 'R3828:Usp15'
ID273857
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Nameubiquitin specific peptidase 15
SynonymsGcap18, 4921514G19Rik, E430033I05Rik
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location123105006-123196995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123196870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 16 (I16F)
Ref Sequence ENSEMBL: ENSMUSP00000151244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020334
AA Change: I16F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: I16F

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219010
Predicted Effect unknown
Transcript: ENSMUST00000219619
AA Change: I19F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220284
Predicted Effect possibly damaging
Transcript: ENSMUST00000220377
AA Change: I16F

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.4404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 123113596 missense probably benign 0.00
IGL02148:Usp15 APN 10 123127837 missense probably damaging 1.00
IGL02737:Usp15 APN 10 123131032 missense probably damaging 1.00
IGL03054:Usp15 APN 10 123125931 splice site probably benign
IGL03163:Usp15 APN 10 123171144 missense probably damaging 0.96
R1755:Usp15 UTSW 10 123133044 missense probably damaging 0.98
R1981:Usp15 UTSW 10 123125041 splice site probably benign
R2049:Usp15 UTSW 10 123119137 missense probably damaging 1.00
R3037:Usp15 UTSW 10 123163617 missense probably damaging 1.00
R3698:Usp15 UTSW 10 123181738 missense probably damaging 1.00
R3845:Usp15 UTSW 10 123119135 missense probably damaging 1.00
R4838:Usp15 UTSW 10 123127757 missense probably damaging 0.99
R4954:Usp15 UTSW 10 123131398 missense probably damaging 1.00
R5204:Usp15 UTSW 10 123113640 missense probably benign 0.06
R5274:Usp15 UTSW 10 123168351 missense probably damaging 1.00
R5387:Usp15 UTSW 10 123131286 missense probably damaging 0.96
R5474:Usp15 UTSW 10 123128045 missense probably damaging 1.00
R5501:Usp15 UTSW 10 123175899 missense probably damaging 0.99
R5665:Usp15 UTSW 10 123130987 nonsense probably null
R5846:Usp15 UTSW 10 123181742 missense probably damaging 1.00
R5850:Usp15 UTSW 10 123124512 critical splice donor site probably null
R6163:Usp15 UTSW 10 123168305 missense probably damaging 1.00
R6735:Usp15 UTSW 10 123168367 missense possibly damaging 0.86
R6828:Usp15 UTSW 10 123127989 missense probably damaging 1.00
R7170:Usp15 UTSW 10 123171195 missense probably damaging 1.00
R7197:Usp15 UTSW 10 123131005 missense possibly damaging 0.92
R7351:Usp15 UTSW 10 123132999 missense probably damaging 1.00
R7368:Usp15 UTSW 10 123196893 missense possibly damaging 0.86
R7447:Usp15 UTSW 10 123175881 missense probably damaging 1.00
R8099:Usp15 UTSW 10 123146921 missense possibly damaging 0.87
R8169:Usp15 UTSW 10 123125893 missense
R8316:Usp15 UTSW 10 123123943 missense
Z1176:Usp15 UTSW 10 123196961 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCCAAAATCTGCTGCCTGAG -3'
(R):5'- AACCGTGCAAACTCAGAGGTC -3'

Sequencing Primer
(F):5'- TGTCCGCACCTGTCACCA -3'
(R):5'- CTCAGAGGTCTGGGGCG -3'
Posted On2015-04-02