Incidental Mutation 'R3828:Camk2b'
ID273858
Institutional Source Beutler Lab
Gene Symbol Camk2b
Ensembl Gene ENSMUSG00000057897
Gene Namecalcium/calmodulin-dependent protein kinase II, beta
SynonymsCaMK II
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5969644-6066362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6028932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 32 (V32A)
Ref Sequence ENSEMBL: ENSMUSP00000105440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002817] [ENSMUST00000019133] [ENSMUST00000066431] [ENSMUST00000090443] [ENSMUST00000093355] [ENSMUST00000101585] [ENSMUST00000101586] [ENSMUST00000109812] [ENSMUST00000109813] [ENSMUST00000109815]
Predicted Effect probably damaging
Transcript: ENSMUST00000002817
AA Change: V32A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002817
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 371 498 5.3e-63 PFAM
Pfam:DUF4440 375 489 2.8e-15 PFAM
Pfam:SnoaL_3 375 500 2.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000019133
AA Change: V32A

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019133
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 511 533 N/A INTRINSIC
Pfam:CaMKII_AD 534 661 3.7e-62 PFAM
Pfam:DUF4440 538 652 1.6e-13 PFAM
Pfam:SnoaL_3 538 663 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066431
AA Change: V32A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065101
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 347 474 4.8e-63 PFAM
Pfam:DUF4440 351 465 2.6e-15 PFAM
Pfam:SnoaL_3 351 476 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090443
AA Change: V32A

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087925
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 390 412 N/A INTRINSIC
Pfam:CaMKII_AD 413 540 6.1e-63 PFAM
Pfam:DUF4440 417 531 3.2e-15 PFAM
Pfam:SnoaL_3 417 542 2.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093355
AA Change: V32A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091046
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
internal_repeat_1 373 388 8.07e-7 PROSPERO
low complexity region 391 414 N/A INTRINSIC
internal_repeat_1 416 431 8.07e-7 PROSPERO
low complexity region 434 456 N/A INTRINSIC
Pfam:CaMKII_AD 457 584 5.8e-63 PFAM
Pfam:DUF4440 461 575 6.7e-15 PFAM
Pfam:SnoaL_3 461 586 4.8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101585
AA Change: V32A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099119
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101586
AA Change: V32A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099120
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109812
AA Change: V32A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105437
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 283 5.98e-95 SMART
Pfam:CaMKII_AD 397 524 5.8e-63 PFAM
Pfam:DUF4440 401 515 3.1e-15 PFAM
Pfam:SnoaL_3 401 526 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109813
AA Change: V32A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105438
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109815
AA Change: V32A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105440
Gene: ENSMUSG00000057897
AA Change: V32A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154197
Meta Mutation Damage Score 0.1523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reversal of plasticity direction at parallel fiber-Purkinje cell synapses. Mice homozygous for a different null allele show motor impairments, including ataxia, altered body mass composition, a reduction in anxiety-related behavior, and cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Camk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Camk2b APN 11 5972310 missense probably damaging 1.00
IGL01821:Camk2b APN 11 5997890 missense possibly damaging 0.92
IGL02219:Camk2b APN 11 5976872 missense possibly damaging 0.56
IGL02890:Camk2b APN 11 6001340 missense possibly damaging 0.90
R1645:Camk2b UTSW 11 5972719 missense probably damaging 1.00
R1786:Camk2b UTSW 11 5977880 missense probably benign 0.06
R1836:Camk2b UTSW 11 5972384 missense probably damaging 1.00
R2133:Camk2b UTSW 11 5977880 missense probably benign 0.06
R4283:Camk2b UTSW 11 5987099 missense probably benign 0.39
R5919:Camk2b UTSW 11 5979718 missense probably damaging 1.00
R6074:Camk2b UTSW 11 5989635 missense probably damaging 1.00
R6269:Camk2b UTSW 11 5978497 missense probably damaging 1.00
R6595:Camk2b UTSW 11 5992856 missense probably damaging 1.00
R6999:Camk2b UTSW 11 5972321 missense probably damaging 1.00
R7030:Camk2b UTSW 11 5989575 missense probably damaging 1.00
R7396:Camk2b UTSW 11 5978432 missense probably benign
R7798:Camk2b UTSW 11 5978399 missense probably benign 0.08
R7818:Camk2b UTSW 11 5977812 missense probably benign
R8342:Camk2b UTSW 11 5990383 missense probably benign 0.21
R8388:Camk2b UTSW 11 5989026 missense probably damaging 1.00
RF023:Camk2b UTSW 11 5972301 missense probably damaging 0.96
Z1176:Camk2b UTSW 11 5977940 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACCATCTTGAAGGCAATGACAC -3'
(R):5'- CCACAAGAGTATATGTGTGGCC -3'

Sequencing Primer
(F):5'- TCTTGAAGGCAATGACACTCCTG -3'
(R):5'- ACAAGAGTATATGTGTGGCCCTGTC -3'
Posted On2015-04-02