Incidental Mutation 'R3828:Cbr2'
ID273860
Institutional Source Beutler Lab
Gene Symbol Cbr2
Ensembl Gene ENSMUSG00000025150
Gene Namecarbonyl reductase 2
SynonymsMLCR, lung carbonyl reductase
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120729489-120732114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120730452 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 140 (H140Q)
Ref Sequence ENSEMBL: ENSMUSP00000026148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148]
PDB Structure
CARBONYL REDUCTASE COMPLEXED WITH NADPH AND 2-PROPANOL [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026144
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026148
AA Change: H140Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150
AA Change: H140Q

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106148
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154479
Predicted Effect unknown
Transcript: ENSMUST00000154565
AA Change: H67Q
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150
AA Change: H67Q

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Cbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Cbr2 UTSW 11 120730788 missense probably benign
R0211:Cbr2 UTSW 11 120730788 missense probably benign
R0971:Cbr2 UTSW 11 120730433 missense probably benign 0.16
R1573:Cbr2 UTSW 11 120731965 missense possibly damaging 0.70
R2093:Cbr2 UTSW 11 120730429 missense probably benign 0.00
R3829:Cbr2 UTSW 11 120730452 missense probably benign
R4403:Cbr2 UTSW 11 120730802 missense probably damaging 1.00
R5011:Cbr2 UTSW 11 120730871 missense possibly damaging 0.92
R7199:Cbr2 UTSW 11 120730261 missense probably benign 0.00
R7535:Cbr2 UTSW 11 120729802 missense probably damaging 1.00
R7714:Cbr2 UTSW 11 120729802 missense probably benign 0.02
R7962:Cbr2 UTSW 11 120729783 missense probably benign 0.03
R8158:Cbr2 UTSW 11 120730297 missense probably damaging 0.98
Z1177:Cbr2 UTSW 11 120730279 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGTGGCCCTAGTTCCATG -3'
(R):5'- AGGTCCTTCAGTGTAAATCTTCGC -3'

Sequencing Primer
(F):5'- GCCCTAGTTCCATGGCCATG -3'
(R):5'- CAGTGTAAATCTTCGCTCTGTG -3'
Posted On2015-04-02