Incidental Mutation 'R3828:Rrm2'
ID273861
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Nameribonucleotide reductase M2
SynonymsR2
MMRRC Submission 040886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3828 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location24708241-24714146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24708599 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 47 (A47S)
Ref Sequence ENSEMBL: ENSMUSP00000020980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
PDB Structure
SMALL SUBUNIT C-TERMINAL INHIBITORY PEPTIDE OF MOUSE RIBONUCLEOTIDE REDUCTASE AS BOUND TO THE LARGE SUBUNIT, NMR, 26 STRUCTURES [SOLUTION NMR]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER OXIDIZING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER REDUCING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER AND BOUND ACETATE. [X-RAY DIFFRACTION]
PROTEIN R2 OF RIBONUCLEOTIDE REDUCTASE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020980
AA Change: A47S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: A47S

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147789
Predicted Effect probably benign
Transcript: ENSMUST00000153058
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154588
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Camk2b A G 11: 6,028,932 V32A probably damaging Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cdk19 T C 10: 40,475,613 V258A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cxcr6 A T 9: 123,810,869 M319L probably benign Het
Dlg5 T A 14: 24,146,158 K1308I probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gm5862 T G 5: 26,019,347 H208P probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Ino80d A T 1: 63,062,078 M463K possibly damaging Het
Lrp2 G A 2: 69,426,012 P4595S probably benign Het
Mark4 A G 7: 19,443,187 I239T possibly damaging Het
Mcoln1 C T 8: 3,500,601 A2V possibly damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Mrgprb5 T A 7: 48,168,091 M299L probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Olfr679 A G 7: 105,086,297 N194D probably benign Het
Pcdhga4 G T 18: 37,687,601 L734F possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Syt14 T C 1: 192,901,775 N444S probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnks A G 8: 34,873,178 F429L probably damaging Het
Usp15 T A 10: 123,196,870 I16F possibly damaging Het
Vps50 T C 6: 3,533,500 I244T probably benign Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3827:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3851:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R4192:Rrm2 UTSW 12 24708378 missense probably benign 0.04
R5274:Rrm2 UTSW 12 24710407 nonsense probably null
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCTGACAAGGAGAACAC -3'
(R):5'- ATCTCGTGTGCTTAGCTGTC -3'

Sequencing Primer
(F):5'- AACACGGTGAGGGCGGC -3'
(R):5'- GACCCGAGTAGGACATTCTG -3'
Posted On2015-04-02