Incidental Mutation 'R3829:Yrdc'
ID273882
Institutional Source Beutler Lab
Gene Symbol Yrdc
Ensembl Gene ENSMUSG00000028889
Gene NameyrdC domain containing (E.coli)
SynonymsIRIP
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124850679-124855242 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 124851761 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000114150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000064444] [ENSMUST00000102628] [ENSMUST00000106190] [ENSMUST00000106193] [ENSMUST00000137769] [ENSMUST00000144851] [ENSMUST00000163946] [ENSMUST00000185036]
Predicted Effect probably benign
Transcript: ENSMUST00000030723
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064444
SMART Domains Protein: ENSMUSP00000066000
Gene: ENSMUSG00000042763

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
low complexity region 55 79 N/A INTRINSIC
Pfam:Glyco_hydro_99 95 445 8.7e-160 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102628
AA Change: M154K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099688
Gene: ENSMUSG00000028889
AA Change: M154K

DomainStartEndE-ValueType
low complexity region 32 63 N/A INTRINSIC
Pfam:Sua5_yciO_yrdC 76 256 1.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106190
SMART Domains Protein: ENSMUSP00000101796
Gene: ENSMUSG00000078570

DomainStartEndE-ValueType
Pfam:DUF4726 10 110 2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106193
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125776
Predicted Effect probably benign
Transcript: ENSMUST00000137769
Predicted Effect probably null
Transcript: ENSMUST00000144851
AA Change: M1K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114150
Gene: ENSMUSG00000028889
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Sua5_yciO_yrdC 1 103 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184704
Predicted Effect probably benign
Transcript: ENSMUST00000185036
SMART Domains Protein: ENSMUSP00000139121
Gene: ENSMUSG00000078570

DomainStartEndE-ValueType
low complexity region 66 89 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
Meta Mutation Damage Score 0.6151 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Yrdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Yrdc APN 4 124853961 missense probably damaging 1.00
IGL01142:Yrdc APN 4 124853994 missense probably damaging 0.98
R0525:Yrdc UTSW 4 124851766 missense probably damaging 1.00
R1162:Yrdc UTSW 4 124854461 unclassified probably benign
R1220:Yrdc UTSW 4 124854536 missense possibly damaging 0.62
R1952:Yrdc UTSW 4 124851946 missense probably benign 0.00
R7121:Yrdc UTSW 4 124850955 missense probably benign 0.06
R7272:Yrdc UTSW 4 124851027 missense probably benign 0.23
Z1176:Yrdc UTSW 4 124851497 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGTCTTCTGCCAGAAC -3'
(R):5'- GAAGGCATGGTCAGGAATCC -3'

Sequencing Primer
(F):5'- GGTAGATCTCGTTCATTATACACGCG -3'
(R):5'- CATGGTCAGGAATCCGGATGC -3'
Posted On2015-04-02