Incidental Mutation 'R3829:Dhx37'
ID273889
Institutional Source Beutler Lab
Gene Symbol Dhx37
Ensembl Gene ENSMUSG00000029480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 37
SynonymsLOC381671, LOC208144
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location125413858-125434121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125431613 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 86 (K86R)
Ref Sequence ENSEMBL: ENSMUSP00000131734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169485]
Predicted Effect probably benign
Transcript: ENSMUST00000169485
AA Change: K86R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131734
Gene: ENSMUSG00000029480
AA Change: K86R

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
DEXDc 246 438 3.55e-27 SMART
AAA 263 463 9.3e-3 SMART
HELICc 554 669 1.56e-14 SMART
Blast:DEXDc 678 717 1e-10 BLAST
HA2 729 852 3.32e-25 SMART
Pfam:OB_NTP_bind 886 1004 1.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198475
Predicted Effect probably benign
Transcript: ENSMUST00000198746
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Dhx37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Dhx37 APN 5 125419088 missense possibly damaging 0.84
IGL02010:Dhx37 APN 5 125418713 missense possibly damaging 0.58
IGL02412:Dhx37 APN 5 125431628 missense probably damaging 0.98
IGL02484:Dhx37 APN 5 125419337 missense possibly damaging 0.89
IGL02986:Dhx37 APN 5 125419315 missense probably damaging 1.00
FR4304:Dhx37 UTSW 5 125427530 unclassified probably benign
R0010:Dhx37 UTSW 5 125431616 missense probably benign 0.02
R0019:Dhx37 UTSW 5 125430034 missense probably benign 0.36
R0485:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R0959:Dhx37 UTSW 5 125423432 missense probably benign
R1101:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R1132:Dhx37 UTSW 5 125421039 missense probably damaging 0.96
R1309:Dhx37 UTSW 5 125417438 nonsense probably null
R1777:Dhx37 UTSW 5 125429931 missense probably benign
R2001:Dhx37 UTSW 5 125427464 missense probably damaging 1.00
R2116:Dhx37 UTSW 5 125421102 missense probably damaging 0.98
R3826:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3830:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R4007:Dhx37 UTSW 5 125424931 splice site probably benign
R5058:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R5158:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R5436:Dhx37 UTSW 5 125429803 missense probably benign
R5789:Dhx37 UTSW 5 125421039 missense possibly damaging 0.55
R5834:Dhx37 UTSW 5 125425730 missense probably damaging 1.00
R6066:Dhx37 UTSW 5 125424666 missense probably benign 0.18
R6490:Dhx37 UTSW 5 125419132 missense probably benign 0.00
R6967:Dhx37 UTSW 5 125422167 missense probably benign 0.07
R7101:Dhx37 UTSW 5 125424942 nonsense probably null
R8036:Dhx37 UTSW 5 125424675 missense probably benign
Z1088:Dhx37 UTSW 5 125416591 missense possibly damaging 0.72
Z1177:Dhx37 UTSW 5 125424980 missense possibly damaging 0.81
Z1177:Dhx37 UTSW 5 125425472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAATTTTGAAATCAGGCCAGC -3'
(R):5'- TCTGTTCGTCTTTTCAGGCAAG -3'

Sequencing Primer
(F):5'- CAATGATGCCACCTGTAGCTAGTG -3'
(R):5'- CTTTTCAGGCAAGGATGTGTTGAAAG -3'
Posted On2015-04-02