Incidental Mutation 'R3829:Srrm3'
ID273890
Institutional Source Beutler Lab
Gene Symbol Srrm3
Ensembl Gene ENSMUSG00000039860
Gene Nameserine/arginine repetitive matrix 3
Synonyms2900083I11Rik, Srrm2l, SRm300-like
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R3829 (G1)
Quality Score158
Status Validated
Chromosome5
Chromosomal Location135806890-135874772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135857214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 336 (D336G)
Ref Sequence ENSEMBL: ENSMUSP00000115695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013615] [ENSMUST00000126232] [ENSMUST00000144211]
Predicted Effect probably damaging
Transcript: ENSMUST00000013615
AA Change: D336G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860
AA Change: D336G

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135615
Predicted Effect probably damaging
Transcript: ENSMUST00000144211
AA Change: D336G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860
AA Change: D336G

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Srrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Srrm3 APN 5 135835249 missense probably damaging 1.00
IGL02716:Srrm3 APN 5 135854433 splice site probably null
IGL03099:Srrm3 APN 5 135869298 splice site probably benign
P0047:Srrm3 UTSW 5 135852926 splice site probably null
R0688:Srrm3 UTSW 5 135869276 utr 3 prime probably benign
R0811:Srrm3 UTSW 5 135873282 unclassified probably benign
R0812:Srrm3 UTSW 5 135873282 unclassified probably benign
R1083:Srrm3 UTSW 5 135854409 missense probably damaging 0.99
R1161:Srrm3 UTSW 5 135854392 small deletion probably benign
R1656:Srrm3 UTSW 5 135835038 critical splice acceptor site probably null
R1694:Srrm3 UTSW 5 135873225 unclassified probably benign
R1803:Srrm3 UTSW 5 135857129 missense probably damaging 0.99
R2037:Srrm3 UTSW 5 135854377 missense probably damaging 1.00
R2436:Srrm3 UTSW 5 135835176 nonsense probably null
R3826:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R4840:Srrm3 UTSW 5 135854595 missense possibly damaging 0.81
R6526:Srrm3 UTSW 5 135835234 missense probably damaging 1.00
R6843:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R7408:Srrm3 UTSW 5 135852206 missense probably benign 0.04
R7583:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R8096:Srrm3 UTSW 5 135869240 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAAACCAGGTCAGTTGCAG -3'
(R):5'- CTCCTTGTAGAGCACAGGTC -3'

Sequencing Primer
(F):5'- TCTGCTCCCCCAGACTGAG -3'
(R):5'- CCTTGTAGAGCACAGGTCAGAGG -3'
Posted On2015-04-02