Incidental Mutation 'R3829:Ppp2r1b'
ID273896
Institutional Source Beutler Lab
Gene Symbol Ppp2r1b
Ensembl Gene ENSMUSG00000032058
Gene Nameprotein phosphatase 2, regulatory subunit A, beta
Synonyms2410091N08Rik
MMRRC Submission 040776-MU
Accession Numbers

Ncbi RefSeq: NM_001034085.1, NM_028614.2; MGI:1920949

Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50845301-50894229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50862494 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 223 (N223S)
Ref Sequence ENSEMBL: ENSMUSP00000034560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000114437] [ENSMUST00000174628] [ENSMUST00000175640] [ENSMUST00000175645] [ENSMUST00000175926] [ENSMUST00000176349] [ENSMUST00000176798]
Predicted Effect probably benign
Transcript: ENSMUST00000034560
AA Change: N223S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114437
AA Change: N223S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110080
Gene: ENSMUSG00000032058
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 1.6e-6 PFAM
Pfam:HEAT_EZ 180 243 7.3e-6 PFAM
Pfam:HEAT 217 247 4.3e-5 PFAM
Pfam:HEAT 295 325 4.2e-6 PFAM
Pfam:HEAT_2 378 479 9e-11 PFAM
Pfam:HEAT_2 494 597 4.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174555
Predicted Effect probably benign
Transcript: ENSMUST00000174628
AA Change: N223S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175640
SMART Domains Protein: ENSMUSP00000134740
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 129 159 5.7e-5 PFAM
Pfam:HEAT 168 198 4e-6 PFAM
Pfam:HEAT_2 251 352 6.3e-11 PFAM
Pfam:HEAT_2 365 470 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175645
AA Change: N223S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135871
Gene: ENSMUSG00000032058
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT_EZ 173 243 8e-6 PFAM
Pfam:HEAT 178 208 1.8e-6 PFAM
Pfam:HEAT 217 247 4.9e-5 PFAM
Pfam:HEAT 295 325 4.8e-6 PFAM
Pfam:HEAT_2 449 552 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175926
SMART Domains Protein: ENSMUSP00000134886
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
SCOP:d1b3ua_ 14 104 4e-15 SMART
PDB:3DW8|D 22 104 4e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176349
AA Change: N159S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058
AA Change: N159S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176798
AA Change: N223S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058
AA Change: N223S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Ppp2r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL01623:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL02120:Ppp2r1b APN 9 50861769 splice site probably benign
IGL02158:Ppp2r1b APN 9 50861609 missense probably benign 0.02
IGL02706:Ppp2r1b APN 9 50878834 missense possibly damaging 0.83
IGL02801:Ppp2r1b APN 9 50878827 missense probably benign 0.00
IGL02943:Ppp2r1b APN 9 50883585 missense probably damaging 1.00
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0211:Ppp2r1b UTSW 9 50861625 missense probably benign 0.00
R0603:Ppp2r1b UTSW 9 50861685 missense probably damaging 1.00
R1219:Ppp2r1b UTSW 9 50867321 splice site probably benign
R1513:Ppp2r1b UTSW 9 50870145 missense probably damaging 1.00
R1545:Ppp2r1b UTSW 9 50862425 missense possibly damaging 0.68
R1997:Ppp2r1b UTSW 9 50867371 missense possibly damaging 0.71
R1998:Ppp2r1b UTSW 9 50883585 missense probably damaging 1.00
R2153:Ppp2r1b UTSW 9 50866554 missense probably damaging 1.00
R4672:Ppp2r1b UTSW 9 50867719 missense probably damaging 0.99
R5299:Ppp2r1b UTSW 9 50857040 missense probably benign 0.04
R5376:Ppp2r1b UTSW 9 50866928 missense possibly damaging 0.78
R5504:Ppp2r1b UTSW 9 50858887 missense probably damaging 1.00
R5700:Ppp2r1b UTSW 9 50878157 missense probably damaging 1.00
R5771:Ppp2r1b UTSW 9 50866832 missense probably damaging 0.98
R7547:Ppp2r1b UTSW 9 50862462 missense probably benign 0.06
R7626:Ppp2r1b UTSW 9 50878176 missense possibly damaging 0.91
Z1088:Ppp2r1b UTSW 9 50866911 missense probably damaging 1.00
Z1176:Ppp2r1b UTSW 9 50873645 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGGCTCTGTGTTGCACTTG -3'
(R):5'- ATTCTGAAAGGCACCTGTCC -3'

Sequencing Primer
(F):5'- TGGTGCACGCTTACCCATG -3'
(R):5'- TGAAAGGCACCTGTCCCCAAG -3'
Posted On2015-04-02