Incidental Mutation 'R3829:Phip'
ID273898
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission 040776-MU
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82871645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1682 (I1682T)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
Predicted Effect probably benign
Transcript: ENSMUST00000034787
AA Change: I1682T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: I1682T

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190774
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2070:Phip UTSW 9 82875299 missense probably benign
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
R7598:Phip UTSW 9 82905658 missense possibly damaging 0.94
R7632:Phip UTSW 9 82903190 missense probably benign
R7752:Phip UTSW 9 82890150 missense probably benign
R7827:Phip UTSW 9 82908833 missense probably benign
R7901:Phip UTSW 9 82890150 missense probably benign
R7984:Phip UTSW 9 82890150 missense probably benign
R8006:Phip UTSW 9 82890126 missense possibly damaging 0.93
R8066:Phip UTSW 9 82875298 missense probably benign 0.05
R8080:Phip UTSW 9 82887609 missense probably damaging 1.00
R8135:Phip UTSW 9 82930374 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTCATGTGAGGCTCAGAGC -3'
(R):5'- TTCAAGTAAATGGCCATGGAGG -3'

Sequencing Primer
(F):5'- GCTCAGAGCCTTTGAGTTCTTC -3'
(R):5'- GGAGGACAACCATCAAAACTCGTG -3'
Posted On2015-04-02