Incidental Mutation 'R3829:Rtkn2'
ID273901
Institutional Source Beutler Lab
Gene Symbol Rtkn2
Ensembl Gene ENSMUSG00000037846
Gene Namerhotekin 2
SynonymsPlekhk1, B130039D23Rik, RTKN2, Mbf
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67979570-68059740 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 67997626 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068994] [ENSMUST00000105437] [ENSMUST00000105437] [ENSMUST00000117086] [ENSMUST00000117086] [ENSMUST00000118160] [ENSMUST00000118160] [ENSMUST00000147556]
Predicted Effect probably benign
Transcript: ENSMUST00000068994
SMART Domains Protein: ENSMUSP00000070717
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 93 243 4.9e-37 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105437
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105437
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117086
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117086
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118160
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118160
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147556
SMART Domains Protein: ENSMUSP00000116166
Gene: ENSMUSG00000037846

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Rtkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rtkn2 APN 10 68041664 missense probably benign 0.00
IGL01338:Rtkn2 APN 10 68025519 missense possibly damaging 0.83
IGL01865:Rtkn2 APN 10 68035875 missense probably benign 0.44
IGL03074:Rtkn2 APN 10 68041721 missense probably damaging 0.99
IGL03383:Rtkn2 APN 10 68017837 missense probably damaging 1.00
PIT4520001:Rtkn2 UTSW 10 67987461 missense probably damaging 1.00
R1167:Rtkn2 UTSW 10 67997620 missense probably damaging 1.00
R2166:Rtkn2 UTSW 10 68041696 missense possibly damaging 0.55
R2323:Rtkn2 UTSW 10 68001934 missense probably damaging 1.00
R3826:Rtkn2 UTSW 10 67997626 splice site probably null
R3827:Rtkn2 UTSW 10 67997626 splice site probably null
R3828:Rtkn2 UTSW 10 67997626 splice site probably null
R4742:Rtkn2 UTSW 10 68003314 missense possibly damaging 0.72
R4867:Rtkn2 UTSW 10 68001927 missense probably damaging 0.99
R4871:Rtkn2 UTSW 10 68005633 missense probably damaging 1.00
R4936:Rtkn2 UTSW 10 68041915 makesense probably null
R5009:Rtkn2 UTSW 10 68041409 missense probably benign 0.14
R5709:Rtkn2 UTSW 10 68001970 missense probably benign 0.31
R6295:Rtkn2 UTSW 10 67979699 start gained probably benign
R6307:Rtkn2 UTSW 10 68035832 missense possibly damaging 0.60
R6751:Rtkn2 UTSW 10 68041453 missense probably benign 0.43
R6823:Rtkn2 UTSW 10 68026632 missense probably damaging 0.96
R7011:Rtkn2 UTSW 10 67979665 unclassified probably benign
R7369:Rtkn2 UTSW 10 68041429 missense probably damaging 0.96
R7403:Rtkn2 UTSW 10 68005636 missense probably benign 0.18
R7760:Rtkn2 UTSW 10 68005609 missense probably damaging 1.00
R7803:Rtkn2 UTSW 10 67979813 critical splice donor site probably null
Z1177:Rtkn2 UTSW 10 68025603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACTGAACATCCTTGGAGAC -3'
(R):5'- AGTGACTTGAACACACCTTCC -3'

Sequencing Primer
(F):5'- GGAGACAAATCCTTCACATTGGTCG -3'
(R):5'- TCACTCGAGTGCCTGAAGAG -3'
Posted On2015-04-02