Incidental Mutation 'R3829:Myh1'
ID273905
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67205597 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 301 (I301V)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516] [ENSMUST00000129018]
Predicted Effect probably benign
Transcript: ENSMUST00000018637
AA Change: I301V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: I301V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
AA Change: I301V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: I301V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
AA Change: I301V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: I301V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129018
SMART Domains Protein: ENSMUSP00000115583
Gene: ENSMUSG00000056328

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.7e-17 PFAM
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGCACCTTATAAACATTGAG -3'
(R):5'- TTGGTCATCAATGCTGGGCAC -3'

Sequencing Primer
(F):5'- GCTACTATCTCAAGGGGTCATAAGAC -3'
(R):5'- ACCGTGATCTCCCCCTGAC -3'
Posted On2015-04-02