Mutagenetix > Incidental Mutations

Incidental Mutation 'R3829:Mast4'

273911

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040776-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R3829 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 102738811 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1350 (H1350N)

Ref Sequence

ENSEMBL: ENSMUSP00000128464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099202
AA Change: H1173N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: H1173N

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167058
AA Change: H1350N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: H1350N

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: H1158N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: H1158N

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: H1182N

Meta Mutation Damage Score

0.1429

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	G	T	14: 54,584,509	H466Q	probably damaging	Het
4933411K16Rik	A	T	19: 42,052,883	H151L	probably damaging	Het
A330008L17Rik	A	G	8: 99,421,757		noncoding transcript	Het
Abcc5	C	A	16: 20,365,865	V1015L	probably benign	Het
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Birc6	A	G	17: 74,655,178	K3929R	probably damaging	Het
C1qtnf2	A	G	11: 43,491,321	D320G	probably benign	Het
Cbr2	A	T	11: 120,730,452	H140Q	probably benign	Het
Cbs	T	C	17: 31,617,381		probably benign	Het
Cdc42bpg	T	C	19: 6,317,645	V1015A	probably damaging	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chil6	A	T	3: 106,405,958	M25K	probably benign	Het
Cln5	A	G	14: 103,073,359	D154G	probably damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Cx3cl1	A	T	8: 94,777,306		probably benign	Het
Cyct	T	C	2: 76,354,168	K80E	probably damaging	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
Etl4	T	C	2: 20,785,421	V628A	probably benign	Het
Fam234a	T	C	17: 26,218,189	E172G	probably benign	Het
Foxp2	C	T	6: 15,379,831		probably benign	Het
Frem1	A	T	4: 82,998,930	F592Y	probably damaging	Het
Gm10259	T	G	3: 25,212,529		noncoding transcript	Het
Gm17521	C	A	X: 123,029,225	G149C	unknown	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hap1	G	T	11: 100,356,021	D19E	probably damaging	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mrpl50	T	C	4: 49,514,539	E44G	probably damaging	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Myh1	A	G	11: 67,205,597	I301V	probably benign	Het
Ncapg2	A	T	12: 116,407,318		probably benign	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Neo1	A	G	9: 58,913,169	Y824H	possibly damaging	Het
Olfr99	T	A	17: 37,280,249	Y57F	probably damaging	Het
Orc1	T	A	4: 108,605,631	M635K	probably damaging	Het
Phip	A	G	9: 82,871,645	I1682T	probably benign	Het
Ppp2r1b	A	G	9: 50,862,494	N223S	probably benign	Het
Ralb	A	T	1: 119,471,717	C204S	probably benign	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Rtkn2	A	T	10: 67,997,626		probably null	Het
Srrm3	A	G	5: 135,857,214	D336G	probably damaging	Het
Stk11	T	C	10: 80,127,948		probably null	Het
Svep1	A	G	4: 58,096,177	L1481P	probably damaging	Het
Tiam2	C	G	17: 3,507,701		probably benign	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmprss11b	T	C	5: 86,661,590	T348A	probably damaging	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Veph1	T	A	3: 66,159,327	E413D	possibly damaging	Het
Vmn2r91	T	G	17: 18,105,497	W126G	probably damaging	Het
Yrdc	T	A	4: 124,851,761	M1K	probably null	Het
Zfp445	T	C	9: 122,853,077	M600V	probably benign	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7957:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACGATGTGTCTGACGATTGTG -3'
(R):5'- ACTTTCCCCAGACCAGGATG -3'

Sequencing Primer
(F):5'- TGCATCTTGCTAGGAAAGGCC -3'
(R):5'- CCCAGACCAGGATGGGATG -3'

Posted On

2015-04-02