Incidental Mutation 'R3829:Myg1'
ID273914
Institutional Source Beutler Lab
Gene Symbol Myg1
Ensembl Gene ENSMUSG00000001285
Gene Namemelanocyte proliferating gene 1
SynonymsGamm1
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102331709-102338139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 102337736 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 349 (G349R)
Ref Sequence ENSEMBL: ENSMUSP00000109312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000229900] [ENSMUST00000230481] [ENSMUST00000231061]
Predicted Effect probably damaging
Transcript: ENSMUST00000001331
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285
AA Change: G295R

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113682
AA Change: G349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285
AA Change: G349R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect unknown
Transcript: ENSMUST00000171244
AA Change: G303R
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285
AA Change: G303R

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect probably benign
Transcript: ENSMUST00000231061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display no gross abnormalities but altered sex-dependent anxiety-like behaviors in different tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Myg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Myg1 APN 15 102334338 missense probably benign 0.00
IGL02188:Myg1 APN 15 102337441 missense probably benign 0.08
IGL02373:Myg1 APN 15 102336833 missense probably damaging 0.99
IGL02885:Myg1 APN 15 102332159 missense probably damaging 1.00
IGL03066:Myg1 APN 15 102334366 unclassified probably benign
R0583:Myg1 UTSW 15 102337790 nonsense probably null
R0631:Myg1 UTSW 15 102331849 missense probably benign 0.00
R0835:Myg1 UTSW 15 102332102 missense probably damaging 1.00
R1016:Myg1 UTSW 15 102334351 missense possibly damaging 0.50
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1757:Myg1 UTSW 15 102331829 missense probably benign
R2400:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2428:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2429:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2431:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2997:Myg1 UTSW 15 102337510 missense probably null 1.00
R3683:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3826:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3827:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R4923:Myg1 UTSW 15 102331853 missense probably benign
R5363:Myg1 UTSW 15 102337824 missense probably benign 0.00
R5419:Myg1 UTSW 15 102336962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTCTACCTACCTTGAAGTCTGTC -3'
(R):5'- AGATGGTTGTCAACTGAAAAGC -3'

Sequencing Primer
(F):5'- ACCTTGAAGTCTGTCTCAGCAC -3'
(R):5'- GTTGTCAACTGAAAAGCAAAGCAC -3'
Posted On2015-04-02