Incidental Mutation 'R3829:Olfr99'
ID273920
Institutional Source Beutler Lab
Gene Symbol Olfr99
Ensembl Gene ENSMUSG00000061972
Gene Nameolfactory receptor 99
SynonymsMOR156-1, GA_x6K02T2PSCP-1720261-1719344
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37279043-37283460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37280249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 57 (Y57F)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
Predicted Effect probably damaging
Transcript: ENSMUST00000077585
AA Change: Y57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: Y57F

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect probably damaging
Transcript: ENSMUST00000216328
AA Change: Y57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Olfr99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr99 APN 17 37280000 missense possibly damaging 0.46
IGL02954:Olfr99 APN 17 37280304 missense probably damaging 1.00
R0533:Olfr99 UTSW 17 37280291 nonsense probably null
R1480:Olfr99 UTSW 17 37279745 missense probably benign 0.01
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R3772:Olfr99 UTSW 17 37279854 missense probably benign 0.00
R3826:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3827:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R5210:Olfr99 UTSW 17 37279933 missense probably benign 0.13
R5361:Olfr99 UTSW 17 37279610 missense probably benign 0.02
R6213:Olfr99 UTSW 17 37280373 missense probably benign
R6399:Olfr99 UTSW 17 37279775 missense probably damaging 1.00
R6881:Olfr99 UTSW 17 37280309 missense probably benign 0.01
Z1176:Olfr99 UTSW 17 37279674 missense probably damaging 0.99
Z1177:Olfr99 UTSW 17 37280209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGTAGCGCAGTGGATGAC -3'
(R):5'- ATACAAGACCCGGGATGAACTG -3'

Sequencing Primer
(F):5'- CTGTCAATAGCCATGACTGCTAG -3'
(R):5'- ATGAACTGCAGTCAGGCTC -3'
Posted On2015-04-02