Incidental Mutation 'R3830:Snx5'
ID273932
Institutional Source Beutler Lab
Gene Symbol Snx5
Ensembl Gene ENSMUSG00000027423
Gene Namesorting nexin 5
SynonymsD2Ertd52e, 0910001N05Rik, 1810032P22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144250123-144270906 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 144254901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028909] [ENSMUST00000028909] [ENSMUST00000110030] [ENSMUST00000110030]
Predicted Effect probably null
Transcript: ENSMUST00000028909
SMART Domains Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 6.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028909
SMART Domains Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 6.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110030
SMART Domains Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 1.7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110030
SMART Domains Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 1.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156936
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein functions in endosomal sorting, the phosphoinositide-signaling pathway, and macropinocytosis. This gene may play a role in the tumorigenesis of papillary thyroid carcinoma. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired alveolar epithelial differentiation of type I cells, respiratory failure and lethality during the perinatal and postnatal periods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Snx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Snx5 APN 2 144255565 missense probably benign
IGL01739:Snx5 APN 2 144270405 missense probably benign 0.00
IGL03394:Snx5 APN 2 144253754 missense probably damaging 1.00
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0344:Snx5 UTSW 2 144257208 splice site probably benign
R0848:Snx5 UTSW 2 144253806 missense probably damaging 0.98
R1440:Snx5 UTSW 2 144254811 missense possibly damaging 0.90
R2282:Snx5 UTSW 2 144253675 missense probably benign 0.03
R5727:Snx5 UTSW 2 144260754 missense probably benign 0.00
R6048:Snx5 UTSW 2 144259153 missense probably damaging 0.97
R7497:Snx5 UTSW 2 144257974 missense probably damaging 0.99
R7664:Snx5 UTSW 2 144258004 splice site probably null
R7895:Snx5 UTSW 2 144253820 missense possibly damaging 0.90
R7978:Snx5 UTSW 2 144253820 missense possibly damaging 0.90
Z1088:Snx5 UTSW 2 144252491 missense probably benign 0.29
Z1177:Snx5 UTSW 2 144259079 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCTCTATGTTGAGCATGTAG -3'
(R):5'- AAAGTCCTGGTGGCAGCATC -3'

Sequencing Primer
(F):5'- CATGTAGTATCGGAGGAGCTC -3'
(R):5'- TGGAACTCACTCTGTAGACCG -3'
Posted On2015-04-02