Mutagenetix > Incidental Mutation

Incidental Mutation 'R3830:Svep1'

273936

Institutional Source

Beutler Lab

Gene Symbol

Svep1

Ensembl Gene

ENSMUSG00000028369

Gene Name

sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1

Synonyms

D430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58042442-58206859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58096177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1481 (L1481P)

Ref Sequence

ENSEMBL: ENSMUSP00000045856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042850]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000042850
AA Change: L1481P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: L1481P

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	51	60	N/A	INTRINSIC
VWA	82	261	2.18e-32	SMART
Pfam:GCC2_GCC3	311	361	3.4e-14	PFAM
CCP	379	434	3.62e-8	SMART
CCP	439	494	1.78e-16	SMART
CCP	499	559	2.13e-5	SMART
Pfam:HYR	560	642	1.7e-20	PFAM
Pfam:HYR	643	722	4.6e-15	PFAM
CCP	727	787	3.59e-1	SMART
low complexity region	862	873	N/A	INTRINSIC
Pfam:GCC2_GCC3	1004	1051	3.2e-16	PFAM
Pfam:GCC2_GCC3	1058	1105	5.4e-19	PFAM
Pfam:GCC2_GCC3	1112	1159	7.7e-19	PFAM
EGF	1195	1228	3.12e-7	SMART
EGF_CA	1230	1266	3.93e-13	SMART
EGF_CA	1268	1304	8.3e-12	SMART
EGF_CA	1306	1342	4.59e-14	SMART
EGF_CA	1344	1380	8.69e-15	SMART
EGF_CA	1382	1418	3.42e-13	SMART
Pfam:Pentaxin	1429	1622	1.8e-28	PFAM
Pfam:Laminin_G_3	1432	1589	1.1e-20	PFAM
CCP	1630	1684	1.71e-9	SMART
CCP	1689	1742	2.31e-15	SMART
EGF_CA	1744	1783	5.23e-9	SMART
CCP	1788	1841	4.62e-15	SMART
CCP	1846	1899	8.29e-17	SMART
CCP	1904	1957	1.1e-12	SMART
CCP	1962	2015	5.6e-14	SMART
CCP	2020	2077	4.15e-8	SMART
CCP	2082	2140	8.11e-11	SMART
CCP	2145	2198	4.38e-16	SMART
CCP	2203	2258	1.69e-8	SMART
CCP	2263	2317	1.42e-15	SMART
CCP	2322	2375	3.1e-7	SMART
CCP	2380	2434	4.55e-14	SMART
CCP	2439	2492	6.95e-10	SMART
CCP	2497	2550	8.88e-17	SMART
CCP	2555	2607	1.7e-13	SMART
CCP	2651	2709	1.02e-7	SMART
CCP	2714	2767	9.6e-13	SMART
CCP	2772	2825	3.64e-13	SMART
CCP	2830	2883	6.63e-16	SMART
CCP	2888	2941	2.76e-13	SMART
CCP	2946	2999	4.41e-12	SMART
CCP	3004	3055	4.25e-5	SMART
CCP	3060	3113	5.15e-13	SMART
CCP	3118	3172	2.11e-9	SMART
CCP	3177	3232	1.02e-7	SMART
CCP	3237	3290	6.19e-16	SMART
CCP	3295	3348	5.35e-11	SMART
CCP	3353	3407	8.43e-9	SMART
CCP	3412	3464	2.44e-14	SMART
EGF	3467	3496	1.28e-3	SMART
EGF	3499	3528	1.15e-5	SMART
EGF	3531	3560	2.85e-1	SMART

Meta Mutation Damage Score

0.7966

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agpat5	A	G	8: 18,879,605	E250G	probably benign	Het
Aox4	A	T	1: 58,255,511	T960S	probably damaging	Het
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Capn1	A	T	19: 5,994,847	L465Q	probably damaging	Het
Cd300c	A	G	11: 114,959,627	F117L	probably benign	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Cspg4	T	G	9: 56,897,621	D1905E	probably damaging	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Drd2	T	A	9: 49,402,143	V204D	probably damaging	Het
Gclc	A	T	9: 77,791,960	I520L	probably benign	Het
Gpat3	A	G	5: 100,884,386	D183G	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gprin3	T	C	6: 59,353,633	E563G	probably benign	Het
Grm8	A	T	6: 27,761,229	L332*	probably null	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hecw1	C	T	13: 14,346,058	S198N	probably benign	Het
Kcna2	T	C	3: 107,104,796	I231T	probably benign	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mast4	G	T	13: 102,738,811	H1350N	probably damaging	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr222	G	T	11: 59,571,601	N46K	probably damaging	Het
Pigb	T	C	9: 73,017,473	N468S	probably benign	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Plekhg1	A	G	10: 3,873,400	T123A	probably damaging	Het
Ptges3l	T	C	11: 101,421,617	*67W	probably null	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Six2	G	T	17: 85,685,187	S296Y	probably damaging	Het
Slc5a12	T	A	2: 110,632,736	C392*	probably null	Het
Snx5	A	T	2: 144,254,901		probably null	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het
Zfp729a	A	T	13: 67,619,878	F744Y	probably damaging	Het

Other mutations in Svep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Svep1	APN	4	58176077	missense	probably damaging	0.98
IGL00489:Svep1	APN	4	58068988	missense	possibly damaging	0.71
IGL00496:Svep1	APN	4	58069001	missense	possibly damaging	0.95
IGL00864:Svep1	APN	4	58068533	nonsense	probably null
IGL00904:Svep1	APN	4	58097398	missense	probably benign	0.00
IGL00935:Svep1	APN	4	58090664	missense	possibly damaging	0.71
IGL00963:Svep1	APN	4	58072791	nonsense	probably null
IGL01077:Svep1	APN	4	58068760	missense	possibly damaging	0.71
IGL01084:Svep1	APN	4	58111419	missense	possibly damaging	0.71
IGL01150:Svep1	APN	4	58070302	missense	probably benign	0.04
IGL01161:Svep1	APN	4	58146569	missense	probably damaging	0.96
IGL01360:Svep1	APN	4	58116554	missense	possibly damaging	0.73
IGL01365:Svep1	APN	4	58100878	critical splice acceptor site	probably null
IGL01396:Svep1	APN	4	58068552	missense	possibly damaging	0.85
IGL01601:Svep1	APN	4	58084872	missense	probably damaging	1.00
IGL01636:Svep1	APN	4	58116622	missense	possibly damaging	0.96
IGL01838:Svep1	APN	4	58121910	missense	possibly damaging	0.72
IGL01949:Svep1	APN	4	58176006	missense	probably damaging	1.00
IGL01984:Svep1	APN	4	58068877	missense	possibly damaging	0.93
IGL02005:Svep1	APN	4	58069056	missense	possibly damaging	0.93
IGL02036:Svep1	APN	4	58088245	missense	possibly damaging	0.85
IGL02039:Svep1	APN	4	58123980	critical splice donor site	probably null
IGL02043:Svep1	APN	4	58068556	missense	probably benign	0.19
IGL02073:Svep1	APN	4	58070104	missense	probably benign	0.06
IGL02188:Svep1	APN	4	58068382	missense	possibly damaging	0.71
IGL02256:Svep1	APN	4	58070311	missense	possibly damaging	0.71
IGL02284:Svep1	APN	4	58072819	missense	probably benign	0.32
IGL02323:Svep1	APN	4	58070236	nonsense	probably null
IGL02440:Svep1	APN	4	58145293	missense	probably benign	0.06
IGL02449:Svep1	APN	4	58070296	missense	possibly damaging	0.71
IGL02501:Svep1	APN	4	58145341	splice site	probably benign
IGL02568:Svep1	APN	4	58135441	missense	probably benign	0.42
IGL02625:Svep1	APN	4	58115807	missense	possibly damaging	0.53
IGL02795:Svep1	APN	4	58123223	missense	probably damaging	1.00
IGL02818:Svep1	APN	4	58069804	missense	possibly damaging	0.71
IGL02871:Svep1	APN	4	58100871	missense	probably benign
IGL02875:Svep1	APN	4	58082821	splice site	probably benign
IGL02887:Svep1	APN	4	58145301	missense	probably damaging	1.00
IGL03240:Svep1	APN	4	58048188	missense	possibly damaging	0.73
IGL03243:Svep1	APN	4	58133387	missense	probably benign	0.06
IGL03264:Svep1	APN	4	58066422	splice site	probably benign
IGL03288:Svep1	APN	4	58116532	missense	probably benign	0.01
IGL03340:Svep1	APN	4	58111451	missense	possibly damaging	0.96
IGL03341:Svep1	APN	4	58070308	nonsense	probably null
IGL03348:Svep1	APN	4	58113635	missense	probably damaging	1.00
R0001:Svep1	UTSW	4	58066460	missense	possibly damaging	0.93
R0042:Svep1	UTSW	4	58123192	missense	possibly damaging	0.92
R0042:Svep1	UTSW	4	58123192	missense	possibly damaging	0.92
R0125:Svep1	UTSW	4	58099937	splice site	probably benign
R0142:Svep1	UTSW	4	58118232	missense	probably benign	0.33
R0147:Svep1	UTSW	4	58116608	missense	possibly damaging	0.85
R0148:Svep1	UTSW	4	58116608	missense	possibly damaging	0.85
R0157:Svep1	UTSW	4	58069830	missense	possibly damaging	0.72
R0195:Svep1	UTSW	4	58089514	missense	possibly damaging	0.82
R0197:Svep1	UTSW	4	58070851	missense	possibly damaging	0.71
R0257:Svep1	UTSW	4	58179610	missense	possibly damaging	0.71
R0314:Svep1	UTSW	4	58096331	missense	possibly damaging	0.71
R0316:Svep1	UTSW	4	58072737	missense	probably damaging	0.98
R0322:Svep1	UTSW	4	58057996	splice site	probably benign
R0426:Svep1	UTSW	4	58073333	missense	possibly damaging	0.87
R0446:Svep1	UTSW	4	58088280	missense	probably damaging	1.00
R0457:Svep1	UTSW	4	58118136	missense	probably damaging	1.00
R0471:Svep1	UTSW	4	58054700	missense	possibly damaging	0.85
R0555:Svep1	UTSW	4	58128858	missense	possibly damaging	0.71
R0634:Svep1	UTSW	4	58070661	missense	possibly damaging	0.86
R0636:Svep1	UTSW	4	58073121	nonsense	probably null
R0827:Svep1	UTSW	4	58053113	splice site	probably benign
R1025:Svep1	UTSW	4	58087817	missense	possibly damaging	0.86
R1027:Svep1	UTSW	4	58094084	missense	possibly damaging	0.86
R1069:Svep1	UTSW	4	58070239	missense	probably damaging	1.00
R1161:Svep1	UTSW	4	58069416	missense	possibly damaging	0.71
R1245:Svep1	UTSW	4	58066427	critical splice donor site	probably null
R1282:Svep1	UTSW	4	58100032	missense	possibly damaging	0.93
R1310:Svep1	UTSW	4	58069416	missense	possibly damaging	0.71
R1444:Svep1	UTSW	4	58115754	missense	possibly damaging	0.53
R1460:Svep1	UTSW	4	58068740	missense	possibly damaging	0.85
R1500:Svep1	UTSW	4	58070239	missense	probably damaging	1.00
R1628:Svep1	UTSW	4	58107561	missense	probably benign	0.00
R1712:Svep1	UTSW	4	58070629	missense	probably benign	0.06
R1774:Svep1	UTSW	4	58146562	missense	possibly damaging	0.92
R1783:Svep1	UTSW	4	58073333	missense	probably benign
R1829:Svep1	UTSW	4	58096310	missense	possibly damaging	0.93
R1978:Svep1	UTSW	4	58097292	missense	possibly damaging	0.73
R1993:Svep1	UTSW	4	58064170	critical splice donor site	probably null
R2017:Svep1	UTSW	4	58070568	missense	probably benign	0.08
R2058:Svep1	UTSW	4	58084554	missense	possibly damaging	0.92
R2109:Svep1	UTSW	4	58206030	missense	possibly damaging	0.51
R2215:Svep1	UTSW	4	58138602	splice site	probably benign
R2281:Svep1	UTSW	4	58082677	missense	possibly damaging	0.85
R2504:Svep1	UTSW	4	58135628	splice site	probably null
R2763:Svep1	UTSW	4	58084061	missense	possibly damaging	0.86
R3122:Svep1	UTSW	4	58087845	missense	possibly damaging	0.51
R3605:Svep1	UTSW	4	58066542	missense	probably benign	0.32
R3763:Svep1	UTSW	4	58084833	missense	possibly damaging	0.89
R3827:Svep1	UTSW	4	58096177	missense	probably damaging	0.98
R3829:Svep1	UTSW	4	58096177	missense	probably damaging	0.98
R3910:Svep1	UTSW	4	58145156	critical splice donor site	probably null
R3943:Svep1	UTSW	4	58084807	splice site	probably null
R3944:Svep1	UTSW	4	58084807	splice site	probably null
R4153:Svep1	UTSW	4	58089426	missense	possibly damaging	0.52
R4154:Svep1	UTSW	4	58069068	missense	possibly damaging	0.71
R4191:Svep1	UTSW	4	58046601	missense	possibly damaging	0.86
R4355:Svep1	UTSW	4	58138695	missense	possibly damaging	0.71
R4388:Svep1	UTSW	4	58069249	missense	possibly damaging	0.93
R4532:Svep1	UTSW	4	58068886	missense	possibly damaging	0.52
R4584:Svep1	UTSW	4	58068526	nonsense	probably null
R4592:Svep1	UTSW	4	58084028	missense	possibly damaging	0.93
R4593:Svep1	UTSW	4	58091944	missense	possibly damaging	0.71
R4625:Svep1	UTSW	4	58072698	missense	probably damaging	0.98
R4639:Svep1	UTSW	4	58082724	missense	probably benign
R4700:Svep1	UTSW	4	58097323	missense	possibly damaging	0.71
R4720:Svep1	UTSW	4	58205869	missense	possibly damaging	0.71
R4724:Svep1	UTSW	4	58070752	missense	possibly damaging	0.71
R4753:Svep1	UTSW	4	58053212	missense	probably benign	0.06
R4781:Svep1	UTSW	4	58070340	missense	probably damaging	0.98
R4820:Svep1	UTSW	4	58082664	missense	probably benign	0.27
R4896:Svep1	UTSW	4	58087751	missense	probably benign	0.08
R4905:Svep1	UTSW	4	58069308	missense	probably benign	0.00
R4910:Svep1	UTSW	4	58096276	missense	possibly damaging	0.71
R4972:Svep1	UTSW	4	58087778	missense	possibly damaging	0.71
R5004:Svep1	UTSW	4	58087751	missense	probably benign	0.08
R5088:Svep1	UTSW	4	58120648	missense	possibly damaging	0.73
R5112:Svep1	UTSW	4	58068610	nonsense	probably null
R5185:Svep1	UTSW	4	58084534	missense	probably damaging	0.99
R5302:Svep1	UTSW	4	58096183	missense	possibly damaging	0.71
R5307:Svep1	UTSW	4	58072677	missense	possibly damaging	0.71
R5339:Svep1	UTSW	4	58121892	missense	possibly damaging	0.96
R5379:Svep1	UTSW	4	58072991	missense	possibly damaging	0.51
R5384:Svep1	UTSW	4	58104545	missense	possibly damaging	0.71
R5414:Svep1	UTSW	4	58206322	missense	possibly damaging	0.53
R5514:Svep1	UTSW	4	58044054	missense	possibly damaging	0.53
R5538:Svep1	UTSW	4	58049282	critical splice acceptor site	probably null
R5549:Svep1	UTSW	4	58057954	missense	probably benign	0.32
R5618:Svep1	UTSW	4	58070537	missense	probably benign
R5623:Svep1	UTSW	4	58091964	missense	possibly damaging	0.92
R5686:Svep1	UTSW	4	58072826	missense	possibly damaging	0.71
R5743:Svep1	UTSW	4	58096223	missense	possibly damaging	0.71
R5773:Svep1	UTSW	4	58099985	missense	possibly damaging	0.86
R5809:Svep1	UTSW	4	58116524	missense	possibly damaging	0.73
R5896:Svep1	UTSW	4	58084906	missense	possibly damaging	0.71
R5918:Svep1	UTSW	4	58069345	missense	possibly damaging	0.71
R5969:Svep1	UTSW	4	58070977	nonsense	probably null
R6010:Svep1	UTSW	4	58115832	missense	possibly damaging	0.95
R6187:Svep1	UTSW	4	58072872	missense	probably damaging	1.00
R6192:Svep1	UTSW	4	58104536	missense	possibly damaging	0.92
R6209:Svep1	UTSW	4	58128869	missense	probably benign	0.32
R6234:Svep1	UTSW	4	58113458	splice site	probably null
R6326:Svep1	UTSW	4	58073045	missense	possibly damaging	0.51
R6400:Svep1	UTSW	4	58049169	missense	probably damaging	1.00
R6418:Svep1	UTSW	4	58053126	missense	probably benign	0.01
R6440:Svep1	UTSW	4	58116555	missense	possibly damaging	0.53
R6489:Svep1	UTSW	4	58100066	missense	probably damaging	1.00
R6515:Svep1	UTSW	4	58088280	missense	probably damaging	1.00
R6738:Svep1	UTSW	4	58123180	missense	possibly damaging	0.71
R6773:Svep1	UTSW	4	58049146	missense	possibly damaging	0.71
R6796:Svep1	UTSW	4	58064275	missense	probably benign	0.01
R7055:Svep1	UTSW	4	58064275	missense	probably benign	0.19
R7055:Svep1	UTSW	4	58120642	missense	probably benign	0.33
R7111:Svep1	UTSW	4	58118207	missense	possibly damaging	0.70
R7161:Svep1	UTSW	4	58128859	missense	possibly damaging	0.93
R7162:Svep1	UTSW	4	58070262	missense	possibly damaging	0.71
R7182:Svep1	UTSW	4	58043991	missense	probably benign	0.18
R7292:Svep1	UTSW	4	58111395	missense	possibly damaging	0.71
R7299:Svep1	UTSW	4	58046587	nonsense	probably null
R7301:Svep1	UTSW	4	58046587	nonsense	probably null
R7316:Svep1	UTSW	4	58068763	missense	possibly damaging	0.71
R7337:Svep1	UTSW	4	58108323	missense	probably damaging	0.98
R7391:Svep1	UTSW	4	58145185	missense	probably damaging	0.98
R7402:Svep1	UTSW	4	58069699	missense	possibly damaging	0.71
R7445:Svep1	UTSW	4	58094122	missense	possibly damaging	0.85
R7450:Svep1	UTSW	4	58064248	missense	possibly damaging	0.71
R7492:Svep1	UTSW	4	58066468	missense	possibly damaging	0.51
R7505:Svep1	UTSW	4	58115862	missense	possibly damaging	0.53
R7509:Svep1	UTSW	4	58090683	missense	probably benign	0.40
R7538:Svep1	UTSW	4	58053260	missense	possibly damaging	0.71
R7555:Svep1	UTSW	4	58069422	missense	probably damaging	0.98
R7660:Svep1	UTSW	4	58087782	missense	probably benign	0.32
R7670:Svep1	UTSW	4	58097424	missense	probably damaging	1.00
R7719:Svep1	UTSW	4	58068523	missense	probably damaging	0.97
R7733:Svep1	UTSW	4	58049239	missense	probably benign	0.03
R7781:Svep1	UTSW	4	58069251	missense	possibly damaging	0.71
R7821:Svep1	UTSW	4	58179601	missense	probably damaging	0.99
R7832:Svep1	UTSW	4	58054539	missense	probably benign	0.44
R8017:Svep1	UTSW	4	58146637	missense	probably damaging	0.99
R8019:Svep1	UTSW	4	58146637	missense	probably damaging	0.99
R8066:Svep1	UTSW	4	58113650	missense	probably benign	0.33
R8159:Svep1	UTSW	4	58069396	missense	possibly damaging	0.71
R8159:Svep1	UTSW	4	58087815	missense	probably benign	0.01
R8170:Svep1	UTSW	4	58069378	missense	probably benign	0.00
R8246:Svep1	UTSW	4	58091889	missense	probably damaging	0.96
R8392:Svep1	UTSW	4	58070566	missense	possibly damaging	0.71
R8436:Svep1	UTSW	4	58044053	missense	possibly damaging	0.86
R8544:Svep1	UTSW	4	58206025	missense	probably benign	0.00
R8669:Svep1	UTSW	4	58070119	missense	possibly damaging	0.95
R8707:Svep1	UTSW	4	58070197	nonsense	probably null
R8790:Svep1	UTSW	4	58118145	missense	possibly damaging	0.53
R8804:Svep1	UTSW	4	58206043	missense	possibly damaging	0.86
R8868:Svep1	UTSW	4	58135578	missense	possibly damaging	0.77
R8880:Svep1	UTSW	4	58064204	missense	possibly damaging	0.51
R8949:Svep1	UTSW	4	58054604	missense	possibly damaging	0.85
R9007:Svep1	UTSW	4	58091915	missense	possibly damaging	0.86
R9028:Svep1	UTSW	4	58145199	missense	possibly damaging	0.92
R9131:Svep1	UTSW	4	58087778	missense	possibly damaging	0.71
R9285:Svep1	UTSW	4	58084809	critical splice donor site	probably null
R9302:Svep1	UTSW	4	58120565	missense	possibly damaging	0.53
R9314:Svep1	UTSW	4	58070347	missense	probably damaging	1.00
R9427:Svep1	UTSW	4	58069804	missense	possibly damaging	0.71
R9443:Svep1	UTSW	4	58179697	missense	possibly damaging	0.95
R9473:Svep1	UTSW	4	58064243	missense	probably benign	0.00
R9487:Svep1	UTSW	4	58070517	missense	probably benign
R9494:Svep1	UTSW	4	58070577	missense	possibly damaging	0.51
R9515:Svep1	UTSW	4	58084144	missense	possibly damaging	0.71
R9681:Svep1	UTSW	4	58084959	missense	probably damaging	0.98
X0063:Svep1	UTSW	4	58070468	nonsense	probably null
Z1176:Svep1	UTSW	4	58111386	missense	probably damaging	0.97
Z1176:Svep1	UTSW	4	58115814	missense	possibly damaging	0.93
Z1176:Svep1	UTSW	4	58133415	missense	possibly damaging	0.51
Z1177:Svep1	UTSW	4	58115841	missense	possibly damaging	0.91
Z1177:Svep1	UTSW	4	58206300	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCACATGTGAGCAGTTATCACC -3'
(R):5'- AACAGCCTTCCGGTTTTAACC -3'

Sequencing Primer
(F):5'- CCCATAGAGTTCGTCCAGATG -3'
(R):5'- ACCTGGATTTTGAAGTTTCTGGCATC -3'

Posted On

2015-04-02