Incidental Mutation 'R3830:Gprin3'
ID 273945
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene Name GPRIN family member 3
Synonyms C030038J10Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R3830 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 59324211-59403279 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59330618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 563 (E563G)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
AlphaFold Q8BWS5
Predicted Effect probably benign
Transcript: ENSMUST00000051065
AA Change: E563G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: E563G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,929,621 (GRCm39) E250G probably benign Het
Aox4 A T 1: 58,294,670 (GRCm39) T960S probably damaging Het
Bach2 T A 4: 32,563,150 (GRCm39) L539H probably damaging Het
Capn1 A T 19: 6,044,877 (GRCm39) L465Q probably damaging Het
Cd300c A G 11: 114,850,453 (GRCm39) F117L probably benign Het
Cep104 T G 4: 154,069,400 (GRCm39) M207R probably damaging Het
Chd2 A G 7: 73,141,163 (GRCm39) Y577H possibly damaging Het
Col4a1 C A 8: 11,259,650 (GRCm39) G1341V probably damaging Het
Cplane2 C T 4: 140,945,900 (GRCm39) R148C probably damaging Het
Cspg4 T G 9: 56,804,905 (GRCm39) D1905E probably damaging Het
Dhx37 T C 5: 125,508,677 (GRCm39) K86R probably benign Het
Drd2 T A 9: 49,313,443 (GRCm39) V204D probably damaging Het
Gclc A T 9: 77,699,242 (GRCm39) I520L probably benign Het
Gpat3 A G 5: 101,032,252 (GRCm39) D183G probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Grm8 A T 6: 27,761,228 (GRCm39) L332* probably null Het
Grpel1 T A 5: 36,626,827 (GRCm39) N36K probably benign Het
Hecw1 C T 13: 14,520,643 (GRCm39) S198N probably benign Het
Kcna2 T C 3: 107,012,112 (GRCm39) I231T probably benign Het
Lpcat1 T C 13: 73,637,212 (GRCm39) I114T possibly damaging Het
Mast4 G T 13: 102,875,319 (GRCm39) H1350N probably damaging Het
Ncor2 T C 5: 125,195,756 (GRCm39) probably benign Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or2b11 G T 11: 59,462,427 (GRCm39) N46K probably damaging Het
Pigb T C 9: 72,924,755 (GRCm39) N468S probably benign Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Plekhg1 A G 10: 3,823,400 (GRCm39) T123A probably damaging Het
Ptges3l T C 11: 101,312,443 (GRCm39) *67W probably null Het
Rgs12 G A 5: 35,123,359 (GRCm39) V381M possibly damaging Het
Rrm2 G T 12: 24,758,598 (GRCm39) A47S probably benign Het
Six2 G T 17: 85,992,615 (GRCm39) S296Y probably damaging Het
Slc5a12 T A 2: 110,463,081 (GRCm39) C392* probably null Het
Snx5 A T 2: 144,096,821 (GRCm39) probably null Het
Svep1 A G 4: 58,096,177 (GRCm39) L1481P probably damaging Het
Tspan18 T C 2: 93,050,453 (GRCm39) I57V probably benign Het
Ube3b C A 5: 114,538,012 (GRCm39) Q368K probably damaging Het
Zfhx4 A T 3: 5,466,269 (GRCm39) K2142N probably damaging Het
Zfp729a A T 13: 67,767,997 (GRCm39) F744Y probably damaging Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59,330,822 (GRCm39) missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59,332,310 (GRCm39) utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59,331,176 (GRCm39) missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59,330,147 (GRCm39) missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59,331,458 (GRCm39) missense probably benign 0.02
IGL02801:Gprin3 APN 6 59,331,966 (GRCm39) missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59,332,013 (GRCm39) missense probably benign
creep UTSW 6 59,330,372 (GRCm39) missense probably damaging 0.98
simplex UTSW 6 59,331,545 (GRCm39) missense possibly damaging 0.72
viridae UTSW 6 59,331,921 (GRCm39) missense possibly damaging 0.86
R0505:Gprin3 UTSW 6 59,330,372 (GRCm39) missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59,330,900 (GRCm39) missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59,331,594 (GRCm39) missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59,331,921 (GRCm39) missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59,331,449 (GRCm39) missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59,331,504 (GRCm39) missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59,331,134 (GRCm39) missense probably benign 0.13
R3893:Gprin3 UTSW 6 59,331,464 (GRCm39) missense probably benign 0.12
R3983:Gprin3 UTSW 6 59,331,545 (GRCm39) missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59,330,350 (GRCm39) missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59,331,158 (GRCm39) missense probably benign 0.33
R4944:Gprin3 UTSW 6 59,331,644 (GRCm39) missense probably benign 0.00
R5523:Gprin3 UTSW 6 59,330,931 (GRCm39) nonsense probably null
R5677:Gprin3 UTSW 6 59,330,877 (GRCm39) missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59,331,398 (GRCm39) missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59,331,698 (GRCm39) missense probably benign
R5881:Gprin3 UTSW 6 59,331,771 (GRCm39) missense probably benign 0.18
R6044:Gprin3 UTSW 6 59,330,657 (GRCm39) missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59,330,316 (GRCm39) nonsense probably null
R7140:Gprin3 UTSW 6 59,332,128 (GRCm39) missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59,331,017 (GRCm39) missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59,330,696 (GRCm39) missense probably benign 0.22
R7970:Gprin3 UTSW 6 59,330,150 (GRCm39) missense possibly damaging 0.71
R8129:Gprin3 UTSW 6 59,330,844 (GRCm39) missense probably benign 0.03
R8190:Gprin3 UTSW 6 59,331,456 (GRCm39) missense possibly damaging 0.73
R8291:Gprin3 UTSW 6 59,331,990 (GRCm39) missense possibly damaging 0.47
R8466:Gprin3 UTSW 6 59,331,467 (GRCm39) missense probably benign 0.33
R8466:Gprin3 UTSW 6 59,331,466 (GRCm39) missense possibly damaging 0.73
R9135:Gprin3 UTSW 6 59,330,273 (GRCm39) missense probably benign 0.05
R9182:Gprin3 UTSW 6 59,331,197 (GRCm39) missense probably benign 0.02
R9762:Gprin3 UTSW 6 59,331,236 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTGTCACACTGAGCTCCTTCAG -3'
(R):5'- TGGAGGTGCCAACAAAGACTAC -3'

Sequencing Primer
(F):5'- AGCTCCTTCAGGAACTCGCTG -3'
(R):5'- CTTGGACCCCACTGATAA -3'
Posted On 2015-04-02