Incidental Mutation 'R3830:Chd2'
ID 273946
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Name chromodomain helicase DNA binding protein 2
Synonyms 5630401D06Rik, 2810013C04Rik, 2810040A01Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R3830 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 73076400-73191494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73141163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 577 (Y577H)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
AlphaFold E9PZM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000169922
AA Change: Y577H

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: Y577H

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,929,621 (GRCm39) E250G probably benign Het
Aox4 A T 1: 58,294,670 (GRCm39) T960S probably damaging Het
Bach2 T A 4: 32,563,150 (GRCm39) L539H probably damaging Het
Capn1 A T 19: 6,044,877 (GRCm39) L465Q probably damaging Het
Cd300c A G 11: 114,850,453 (GRCm39) F117L probably benign Het
Cep104 T G 4: 154,069,400 (GRCm39) M207R probably damaging Het
Col4a1 C A 8: 11,259,650 (GRCm39) G1341V probably damaging Het
Cplane2 C T 4: 140,945,900 (GRCm39) R148C probably damaging Het
Cspg4 T G 9: 56,804,905 (GRCm39) D1905E probably damaging Het
Dhx37 T C 5: 125,508,677 (GRCm39) K86R probably benign Het
Drd2 T A 9: 49,313,443 (GRCm39) V204D probably damaging Het
Gclc A T 9: 77,699,242 (GRCm39) I520L probably benign Het
Gpat3 A G 5: 101,032,252 (GRCm39) D183G probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Gprin3 T C 6: 59,330,618 (GRCm39) E563G probably benign Het
Grm8 A T 6: 27,761,228 (GRCm39) L332* probably null Het
Grpel1 T A 5: 36,626,827 (GRCm39) N36K probably benign Het
Hecw1 C T 13: 14,520,643 (GRCm39) S198N probably benign Het
Kcna2 T C 3: 107,012,112 (GRCm39) I231T probably benign Het
Lpcat1 T C 13: 73,637,212 (GRCm39) I114T possibly damaging Het
Mast4 G T 13: 102,875,319 (GRCm39) H1350N probably damaging Het
Ncor2 T C 5: 125,195,756 (GRCm39) probably benign Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or2b11 G T 11: 59,462,427 (GRCm39) N46K probably damaging Het
Pigb T C 9: 72,924,755 (GRCm39) N468S probably benign Het
Pik3r2 G A 8: 71,223,065 (GRCm39) R452C probably benign Het
Plekhg1 A G 10: 3,823,400 (GRCm39) T123A probably damaging Het
Ptges3l T C 11: 101,312,443 (GRCm39) *67W probably null Het
Rgs12 G A 5: 35,123,359 (GRCm39) V381M possibly damaging Het
Rrm2 G T 12: 24,758,598 (GRCm39) A47S probably benign Het
Six2 G T 17: 85,992,615 (GRCm39) S296Y probably damaging Het
Slc5a12 T A 2: 110,463,081 (GRCm39) C392* probably null Het
Snx5 A T 2: 144,096,821 (GRCm39) probably null Het
Svep1 A G 4: 58,096,177 (GRCm39) L1481P probably damaging Het
Tspan18 T C 2: 93,050,453 (GRCm39) I57V probably benign Het
Ube3b C A 5: 114,538,012 (GRCm39) Q368K probably damaging Het
Zfhx4 A T 3: 5,466,269 (GRCm39) K2142N probably damaging Het
Zfp729a A T 13: 67,767,997 (GRCm39) F744Y probably damaging Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73,118,325 (GRCm39) missense probably damaging 0.99
IGL00535:Chd2 APN 7 73,190,576 (GRCm39) missense probably benign 0.01
IGL00961:Chd2 APN 7 73,093,997 (GRCm39) missense probably damaging 0.99
IGL01092:Chd2 APN 7 73,091,434 (GRCm39) missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73,091,375 (GRCm39) splice site probably null
IGL02083:Chd2 APN 7 73,130,816 (GRCm39) missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73,091,465 (GRCm39) missense probably benign 0.01
IGL02243:Chd2 APN 7 73,147,456 (GRCm39) splice site probably null
IGL02385:Chd2 APN 7 73,085,570 (GRCm39) missense probably damaging 1.00
IGL02552:Chd2 APN 7 73,097,068 (GRCm39) unclassified probably benign
IGL02590:Chd2 APN 7 73,102,948 (GRCm39) missense probably benign 0.00
IGL02684:Chd2 APN 7 73,125,097 (GRCm39) missense probably damaging 0.99
IGL02731:Chd2 APN 7 73,143,204 (GRCm39) missense probably damaging 0.99
IGL03272:Chd2 APN 7 73,102,914 (GRCm39) missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73,151,852 (GRCm39) missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73,130,716 (GRCm39) missense probably benign
F6893:Chd2 UTSW 7 73,157,620 (GRCm39) missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0068:Chd2 UTSW 7 73,134,282 (GRCm39) missense probably damaging 1.00
R0763:Chd2 UTSW 7 73,097,022 (GRCm39) missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R0974:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R1223:Chd2 UTSW 7 73,134,265 (GRCm39) missense probably damaging 1.00
R1435:Chd2 UTSW 7 73,102,884 (GRCm39) missense probably damaging 0.99
R1527:Chd2 UTSW 7 73,140,362 (GRCm39) nonsense probably null
R1599:Chd2 UTSW 7 73,122,799 (GRCm39) missense probably benign 0.05
R1657:Chd2 UTSW 7 73,130,178 (GRCm39) missense probably damaging 1.00
R1932:Chd2 UTSW 7 73,104,193 (GRCm39) missense probably damaging 0.99
R2110:Chd2 UTSW 7 73,079,735 (GRCm39) missense probably benign 0.00
R2202:Chd2 UTSW 7 73,128,416 (GRCm39) missense probably benign 0.00
R2383:Chd2 UTSW 7 73,153,168 (GRCm39) missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73,157,631 (GRCm39) missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73,118,238 (GRCm39) missense probably benign 0.35
R3713:Chd2 UTSW 7 73,121,538 (GRCm39) unclassified probably benign
R3788:Chd2 UTSW 7 73,096,878 (GRCm39) unclassified probably benign
R3826:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73,114,143 (GRCm39) splice site probably benign
R4093:Chd2 UTSW 7 73,150,764 (GRCm39) missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73,085,709 (GRCm39) missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73,190,622 (GRCm39) intron probably benign
R4782:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4792:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4799:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73,151,873 (GRCm39) missense probably damaging 1.00
R5055:Chd2 UTSW 7 73,130,256 (GRCm39) missense probably damaging 1.00
R5071:Chd2 UTSW 7 73,079,437 (GRCm39) missense probably benign 0.03
R5328:Chd2 UTSW 7 73,113,429 (GRCm39) missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73,122,833 (GRCm39) missense probably damaging 1.00
R5643:Chd2 UTSW 7 73,134,232 (GRCm39) missense probably damaging 1.00
R5666:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5670:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5706:Chd2 UTSW 7 73,141,105 (GRCm39) missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73,134,350 (GRCm39) splice site probably null
R5834:Chd2 UTSW 7 73,128,463 (GRCm39) missense probably damaging 1.00
R5920:Chd2 UTSW 7 73,187,060 (GRCm39) missense probably damaging 0.97
R6051:Chd2 UTSW 7 73,085,590 (GRCm39) missense probably benign 0.00
R6179:Chd2 UTSW 7 73,094,071 (GRCm39) missense probably damaging 0.98
R6229:Chd2 UTSW 7 73,101,471 (GRCm39) missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73,113,419 (GRCm39) missense probably damaging 0.99
R6310:Chd2 UTSW 7 73,102,912 (GRCm39) missense probably damaging 1.00
R6439:Chd2 UTSW 7 73,130,154 (GRCm39) missense probably damaging 1.00
R6444:Chd2 UTSW 7 73,150,785 (GRCm39) critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73,153,191 (GRCm39) missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73,143,313 (GRCm39) missense probably damaging 0.99
R6661:Chd2 UTSW 7 73,140,230 (GRCm39) missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73,125,127 (GRCm39) nonsense probably null
R6860:Chd2 UTSW 7 73,147,558 (GRCm39) missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73,125,171 (GRCm39) missense probably damaging 1.00
R6984:Chd2 UTSW 7 73,134,159 (GRCm39) nonsense probably null
R7095:Chd2 UTSW 7 73,121,629 (GRCm39) missense probably damaging 1.00
R7121:Chd2 UTSW 7 73,119,418 (GRCm39) missense probably benign 0.00
R7179:Chd2 UTSW 7 73,125,168 (GRCm39) missense probably damaging 1.00
R7500:Chd2 UTSW 7 73,101,556 (GRCm39) missense probably damaging 1.00
R7615:Chd2 UTSW 7 73,091,390 (GRCm39) missense probably damaging 0.97
R7646:Chd2 UTSW 7 73,085,521 (GRCm39) missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73,121,567 (GRCm39) missense probably null 1.00
R7898:Chd2 UTSW 7 73,169,223 (GRCm39) critical splice donor site probably null
R7935:Chd2 UTSW 7 73,149,373 (GRCm39) missense probably benign 0.01
R8033:Chd2 UTSW 7 73,085,628 (GRCm39) missense probably damaging 1.00
R8070:Chd2 UTSW 7 73,101,506 (GRCm39) missense probably benign
R8071:Chd2 UTSW 7 73,187,132 (GRCm39) missense probably benign
R8188:Chd2 UTSW 7 73,079,504 (GRCm39) nonsense probably null
R8196:Chd2 UTSW 7 73,118,285 (GRCm39) missense probably benign 0.00
R8258:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8259:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8357:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8457:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8778:Chd2 UTSW 7 73,079,483 (GRCm39) missense possibly damaging 0.88
R8816:Chd2 UTSW 7 73,140,245 (GRCm39) missense probably damaging 1.00
R8875:Chd2 UTSW 7 73,151,783 (GRCm39) missense probably damaging 1.00
R8935:Chd2 UTSW 7 73,153,210 (GRCm39) missense possibly damaging 0.47
R9005:Chd2 UTSW 7 73,134,294 (GRCm39) missense probably damaging 0.98
R9009:Chd2 UTSW 7 73,143,192 (GRCm39) missense probably benign 0.39
R9009:Chd2 UTSW 7 73,140,402 (GRCm39) missense probably benign 0.12
R9021:Chd2 UTSW 7 73,091,393 (GRCm39) missense probably benign 0.03
R9038:Chd2 UTSW 7 73,105,358 (GRCm39) missense probably damaging 1.00
R9064:Chd2 UTSW 7 73,143,279 (GRCm39) missense possibly damaging 0.70
R9383:Chd2 UTSW 7 73,098,918 (GRCm39) missense probably null 1.00
R9501:Chd2 UTSW 7 73,130,294 (GRCm39) missense probably damaging 1.00
R9501:Chd2 UTSW 7 73,091,481 (GRCm39) missense possibly damaging 0.92
R9550:Chd2 UTSW 7 73,119,439 (GRCm39) missense probably damaging 0.99
R9583:Chd2 UTSW 7 73,130,230 (GRCm39) missense probably damaging 0.99
R9665:Chd2 UTSW 7 73,079,555 (GRCm39) missense probably benign 0.00
RF009:Chd2 UTSW 7 73,169,410 (GRCm39) missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73,157,585 (GRCm39) missense probably benign 0.11
Z1177:Chd2 UTSW 7 73,118,334 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGATTAAGCCACCCTAAGCTC -3'
(R):5'- TCTAGCTTGGGTTACAGCAAG -3'

Sequencing Primer
(F):5'- CTAAGCTCCCATACGGTGAGGTTG -3'
(R):5'- CAGCAAGTCTTCTTAGAGTGCATAGG -3'
Posted On 2015-04-02