Incidental Mutation 'R3830:Agpat5'
ID 273948
Institutional Source Beutler Lab
Gene Symbol Agpat5
Ensembl Gene ENSMUSG00000031467
Gene Name 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)
Synonyms 1110013A05Rik, D8Ertd319e
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.311) question?
Stock # R3830 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 18846277-18891361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18879605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 250 (E250G)
Ref Sequence ENSEMBL: ENSMUSP00000117025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033847] [ENSMUST00000149565]
AlphaFold Q9D1E8
Predicted Effect probably benign
Transcript: ENSMUST00000033847
AA Change: E250G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033847
Gene: ENSMUSG00000031467
AA Change: E250G

DomainStartEndE-ValueType
Blast:PlsC 28 73 1e-15 BLAST
PlsC 87 212 6.14e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149565
AA Change: E250G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117025
Gene: ENSMUSG00000031467
AA Change: E250G

DomainStartEndE-ValueType
Blast:PlsC 28 73 4e-15 BLAST
PlsC 87 212 6.14e-24 SMART
Pfam:Acyltransf_C 249 329 6.4e-17 PFAM
transmembrane domain 346 363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. This integral membrane protein converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. A pseudogene of this gene is present on the Y chromosome. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display moderate fatty changes in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Agpat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Agpat5 APN 8 18876132 critical splice donor site probably null
IGL02529:Agpat5 APN 8 18881754 missense possibly damaging 0.87
PIT4515001:Agpat5 UTSW 8 18846641 missense probably damaging 0.98
R1491:Agpat5 UTSW 8 18846723 missense probably damaging 1.00
R1637:Agpat5 UTSW 8 18881811 missense probably benign 0.21
R1672:Agpat5 UTSW 8 18870914 missense probably benign 0.01
R1913:Agpat5 UTSW 8 18879613 missense probably benign 0.44
R1938:Agpat5 UTSW 8 18878165 missense probably benign 0.00
R1962:Agpat5 UTSW 8 18878010 missense probably damaging 1.00
R4649:Agpat5 UTSW 8 18879652 missense possibly damaging 0.74
R4953:Agpat5 UTSW 8 18868955 missense probably benign 0.41
R5268:Agpat5 UTSW 8 18881862 missense possibly damaging 0.82
R6351:Agpat5 UTSW 8 18846708 missense probably benign 0.02
R8432:Agpat5 UTSW 8 18846761 missense probably benign 0.16
R8507:Agpat5 UTSW 8 18878027 missense possibly damaging 0.87
R8710:Agpat5 UTSW 8 18878089 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTAGAAGTCAGTGACATGGGC -3'
(R):5'- AGACTCCTTTCAAGCAGGGTC -3'

Sequencing Primer
(F):5'- AGTCAGTGACATGGGCTTAAC -3'
(R):5'- CTCCTTTCAAGCAGGGTCTGAGAG -3'
Posted On 2015-04-02