Incidental Mutation 'R3830:Pik3r2'
ID 273950
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Name phosphoinositide-3-kinase regulatory subunit 2
Synonyms p85beta
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3830 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71220820-71229357 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 71223065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 452 (R452C)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
AlphaFold O08908
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
AA Change: R452C

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: R452C

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Meta Mutation Damage Score 0.4834 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,929,621 (GRCm39) E250G probably benign Het
Aox4 A T 1: 58,294,670 (GRCm39) T960S probably damaging Het
Bach2 T A 4: 32,563,150 (GRCm39) L539H probably damaging Het
Capn1 A T 19: 6,044,877 (GRCm39) L465Q probably damaging Het
Cd300c A G 11: 114,850,453 (GRCm39) F117L probably benign Het
Cep104 T G 4: 154,069,400 (GRCm39) M207R probably damaging Het
Chd2 A G 7: 73,141,163 (GRCm39) Y577H possibly damaging Het
Col4a1 C A 8: 11,259,650 (GRCm39) G1341V probably damaging Het
Cplane2 C T 4: 140,945,900 (GRCm39) R148C probably damaging Het
Cspg4 T G 9: 56,804,905 (GRCm39) D1905E probably damaging Het
Dhx37 T C 5: 125,508,677 (GRCm39) K86R probably benign Het
Drd2 T A 9: 49,313,443 (GRCm39) V204D probably damaging Het
Gclc A T 9: 77,699,242 (GRCm39) I520L probably benign Het
Gpat3 A G 5: 101,032,252 (GRCm39) D183G probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Gprin3 T C 6: 59,330,618 (GRCm39) E563G probably benign Het
Grm8 A T 6: 27,761,228 (GRCm39) L332* probably null Het
Grpel1 T A 5: 36,626,827 (GRCm39) N36K probably benign Het
Hecw1 C T 13: 14,520,643 (GRCm39) S198N probably benign Het
Kcna2 T C 3: 107,012,112 (GRCm39) I231T probably benign Het
Lpcat1 T C 13: 73,637,212 (GRCm39) I114T possibly damaging Het
Mast4 G T 13: 102,875,319 (GRCm39) H1350N probably damaging Het
Ncor2 T C 5: 125,195,756 (GRCm39) probably benign Het
Ntn1 C G 11: 68,276,619 (GRCm39) D110H probably damaging Het
Or2b11 G T 11: 59,462,427 (GRCm39) N46K probably damaging Het
Pigb T C 9: 72,924,755 (GRCm39) N468S probably benign Het
Plekhg1 A G 10: 3,823,400 (GRCm39) T123A probably damaging Het
Ptges3l T C 11: 101,312,443 (GRCm39) *67W probably null Het
Rgs12 G A 5: 35,123,359 (GRCm39) V381M possibly damaging Het
Rrm2 G T 12: 24,758,598 (GRCm39) A47S probably benign Het
Six2 G T 17: 85,992,615 (GRCm39) S296Y probably damaging Het
Slc5a12 T A 2: 110,463,081 (GRCm39) C392* probably null Het
Snx5 A T 2: 144,096,821 (GRCm39) probably null Het
Svep1 A G 4: 58,096,177 (GRCm39) L1481P probably damaging Het
Tspan18 T C 2: 93,050,453 (GRCm39) I57V probably benign Het
Ube3b C A 5: 114,538,012 (GRCm39) Q368K probably damaging Het
Zfhx4 A T 3: 5,466,269 (GRCm39) K2142N probably damaging Het
Zfp729a A T 13: 67,767,997 (GRCm39) F744Y probably damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 71,223,073 (GRCm39) missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 71,224,992 (GRCm39) unclassified probably benign
IGL02514:Pik3r2 APN 8 71,223,236 (GRCm39) missense probably benign 0.00
IGL03395:Pik3r2 APN 8 71,224,999 (GRCm39) missense probably benign
kingfisher UTSW 8 71,223,545 (GRCm39) missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 71,223,545 (GRCm39) missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 71,223,545 (GRCm39) missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 71,224,688 (GRCm39) unclassified probably benign
R1636:Pik3r2 UTSW 8 71,224,542 (GRCm39) missense probably benign
R1662:Pik3r2 UTSW 8 71,223,250 (GRCm39) missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 71,222,029 (GRCm39) missense probably benign 0.31
R2879:Pik3r2 UTSW 8 71,225,029 (GRCm39) missense probably benign
R3852:Pik3r2 UTSW 8 71,223,065 (GRCm39) missense probably benign 0.19
R3859:Pik3r2 UTSW 8 71,222,630 (GRCm39) missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 71,223,065 (GRCm39) missense probably benign 0.19
R3968:Pik3r2 UTSW 8 71,223,065 (GRCm39) missense probably benign 0.19
R3969:Pik3r2 UTSW 8 71,223,065 (GRCm39) missense probably benign 0.19
R3970:Pik3r2 UTSW 8 71,223,065 (GRCm39) missense probably benign 0.19
R4606:Pik3r2 UTSW 8 71,224,780 (GRCm39) nonsense probably null
R4666:Pik3r2 UTSW 8 71,221,503 (GRCm39) missense possibly damaging 0.93
R5481:Pik3r2 UTSW 8 71,222,408 (GRCm39) missense probably benign 0.31
R6445:Pik3r2 UTSW 8 71,224,670 (GRCm39) missense probably benign 0.01
R6578:Pik3r2 UTSW 8 71,225,283 (GRCm39) missense probably benign 0.00
R6667:Pik3r2 UTSW 8 71,221,817 (GRCm39) missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 71,223,361 (GRCm39) missense probably benign 0.43
R6863:Pik3r2 UTSW 8 71,223,058 (GRCm39) missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 71,222,025 (GRCm39) missense probably benign 0.03
R7750:Pik3r2 UTSW 8 71,223,545 (GRCm39) missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 71,222,408 (GRCm39) missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 71,225,011 (GRCm39) missense probably benign 0.14
R8237:Pik3r2 UTSW 8 71,224,794 (GRCm39) missense probably benign 0.00
R8414:Pik3r2 UTSW 8 71,223,079 (GRCm39) missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 71,227,312 (GRCm39) missense probably benign
R8781:Pik3r2 UTSW 8 71,222,046 (GRCm39) missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 71,224,007 (GRCm39) missense probably benign
R9322:Pik3r2 UTSW 8 71,227,494 (GRCm39) missense possibly damaging 0.74
R9401:Pik3r2 UTSW 8 71,223,737 (GRCm39) missense possibly damaging 0.77
R9668:Pik3r2 UTSW 8 71,221,459 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTAGATTTGTAAGAAGCACTGG -3'
(R):5'- ATCACTGGCCCAGTACAACG -3'

Sequencing Primer
(F):5'- TTTGTAAGAAGCACTGGGAGGAAATG -3'
(R):5'- CTGTGTCCAAGTACCAACAAGTGTG -3'
Posted On 2015-04-02