Mutagenetix > Incidental Mutation

Incidental Mutation 'R3830:Pik3r2'

273950

Institutional Source

Beutler Lab

Gene Symbol

Pik3r2

Ensembl Gene

ENSMUSG00000031834

Gene Name

phosphoinositide-3-kinase regulatory subunit 2

Synonyms

p85beta

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70768176-70776713 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70770421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 452 (R452C)

Ref Sequence

ENSEMBL: ENSMUSP00000034296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]

AlphaFold

O08908

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034296
AA Change: R452C

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: R452C

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000034299

SMART Domains

Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:GILT	60	163	4e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably benign
Transcript: ENSMUST00000143785

SMART Domains

Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	30	1e-8	BLAST
Pfam:SH2	33	70	4.5e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146707

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152545

Predicted Effect

probably benign
Transcript: ENSMUST00000154685

SMART Domains

Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
PDB:2XS6\|A	43	84	3e-11	PDB
SCOP:d1pbwa_	47	79	6e-9	SMART
Blast:RhoGAP	58	84	4e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222087

Meta Mutation Damage Score

0.4834

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agpat5	A	G	8: 18,879,605	E250G	probably benign	Het
Aox4	A	T	1: 58,255,511	T960S	probably damaging	Het
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Capn1	A	T	19: 5,994,847	L465Q	probably damaging	Het
Cd300c	A	G	11: 114,959,627	F117L	probably benign	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Cspg4	T	G	9: 56,897,621	D1905E	probably damaging	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Drd2	T	A	9: 49,402,143	V204D	probably damaging	Het
Gclc	A	T	9: 77,791,960	I520L	probably benign	Het
Gpat3	A	G	5: 100,884,386	D183G	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gprin3	T	C	6: 59,353,633	E563G	probably benign	Het
Grm8	A	T	6: 27,761,229	L332*	probably null	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hecw1	C	T	13: 14,346,058	S198N	probably benign	Het
Kcna2	T	C	3: 107,104,796	I231T	probably benign	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mast4	G	T	13: 102,738,811	H1350N	probably damaging	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr222	G	T	11: 59,571,601	N46K	probably damaging	Het
Pigb	T	C	9: 73,017,473	N468S	probably benign	Het
Plekhg1	A	G	10: 3,873,400	T123A	probably damaging	Het
Ptges3l	T	C	11: 101,421,617	*67W	probably null	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Six2	G	T	17: 85,685,187	S296Y	probably damaging	Het
Slc5a12	T	A	2: 110,632,736	C392*	probably null	Het
Snx5	A	T	2: 144,254,901		probably null	Het
Svep1	A	G	4: 58,096,177	L1481P	probably damaging	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het
Zfp729a	A	T	13: 67,619,878	F744Y	probably damaging	Het

Other mutations in Pik3r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Pik3r2	APN	8	70770429	missense	probably damaging	1.00
IGL01637:Pik3r2	APN	8	70772348	unclassified	probably benign
IGL02514:Pik3r2	APN	8	70770592	missense	probably benign	0.00
IGL03395:Pik3r2	APN	8	70772355	missense	probably benign
kingfisher	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0022:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R0448:Pik3r2	UTSW	8	70772044	unclassified	probably benign
R1636:Pik3r2	UTSW	8	70771898	missense	probably benign
R1662:Pik3r2	UTSW	8	70770606	missense	probably damaging	1.00
R2114:Pik3r2	UTSW	8	70769385	missense	probably benign	0.31
R2879:Pik3r2	UTSW	8	70772385	missense	probably benign
R3852:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3859:Pik3r2	UTSW	8	70769986	missense	probably damaging	1.00
R3967:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3968:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3969:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R3970:Pik3r2	UTSW	8	70770421	missense	probably benign	0.19
R4606:Pik3r2	UTSW	8	70772136	nonsense	probably null
R4666:Pik3r2	UTSW	8	70768859	missense	possibly damaging	0.93
R5481:Pik3r2	UTSW	8	70769764	missense	probably benign	0.31
R6445:Pik3r2	UTSW	8	70772026	missense	probably benign	0.01
R6578:Pik3r2	UTSW	8	70772639	missense	probably benign	0.00
R6667:Pik3r2	UTSW	8	70769173	missense	probably damaging	1.00
R6794:Pik3r2	UTSW	8	70770717	missense	probably benign	0.43
R6863:Pik3r2	UTSW	8	70770414	missense	probably damaging	1.00
R7378:Pik3r2	UTSW	8	70769381	missense	probably benign	0.03
R7750:Pik3r2	UTSW	8	70770901	missense	probably damaging	1.00
R7821:Pik3r2	UTSW	8	70769764	missense	probably damaging	1.00
R8056:Pik3r2	UTSW	8	70772367	missense	probably benign	0.14
R8237:Pik3r2	UTSW	8	70772150	missense	probably benign	0.00
R8414:Pik3r2	UTSW	8	70770435	missense	probably damaging	1.00
R8534:Pik3r2	UTSW	8	70774668	missense	probably benign
R8781:Pik3r2	UTSW	8	70769402	missense	possibly damaging	0.88
R8794:Pik3r2	UTSW	8	70771363	missense	probably benign
R9322:Pik3r2	UTSW	8	70774850	missense	possibly damaging	0.74
R9401:Pik3r2	UTSW	8	70771093	missense	possibly damaging	0.77
R9668:Pik3r2	UTSW	8	70768815	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCTAGATTTGTAAGAAGCACTGG -3'
(R):5'- ATCACTGGCCCAGTACAACG -3'

Sequencing Primer
(F):5'- TTTGTAAGAAGCACTGGGAGGAAATG -3'
(R):5'- CTGTGTCCAAGTACCAACAAGTGTG -3'

Posted On

2015-04-02