Mutagenetix > Incidental Mutations

Incidental Mutation 'R3830:Cspg4'

273952

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 56897621 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1905 (D1905E)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035661
AA Change: D1905E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: D1905E

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217052

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agpat5	A	G	8: 18,879,605	E250G	probably benign	Het
Aox4	A	T	1: 58,255,511	T960S	probably damaging	Het
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Capn1	A	T	19: 5,994,847	L465Q	probably damaging	Het
Cd300c	A	G	11: 114,959,627	F117L	probably benign	Het
Cep104	T	G	4: 153,984,943	M207R	probably damaging	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Drd2	T	A	9: 49,402,143	V204D	probably damaging	Het
Gclc	A	T	9: 77,791,960	I520L	probably benign	Het
Gpat3	A	G	5: 100,884,386	D183G	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gprin3	T	C	6: 59,353,633	E563G	probably benign	Het
Grm8	A	T	6: 27,761,229	L332*	probably null	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hecw1	C	T	13: 14,346,058	S198N	probably benign	Het
Kcna2	T	C	3: 107,104,796	I231T	probably benign	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mast4	G	T	13: 102,738,811	H1350N	probably damaging	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr222	G	T	11: 59,571,601	N46K	probably damaging	Het
Pigb	T	C	9: 73,017,473	N468S	probably benign	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Plekhg1	A	G	10: 3,873,400	T123A	probably damaging	Het
Ptges3l	T	C	11: 101,421,617	*67W	probably null	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Six2	G	T	17: 85,685,187	S296Y	probably damaging	Het
Slc5a12	T	A	2: 110,632,736	C392*	probably null	Het
Snx5	A	T	2: 144,254,901		probably null	Het
Svep1	A	G	4: 58,096,177	L1481P	probably damaging	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het
Zfp729a	A	T	13: 67,619,878	F744Y	probably damaging	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
R7809:Cspg4	UTSW	9	56890190	missense	probably damaging	1.00
R7940:Cspg4	UTSW	9	56888097	nonsense	probably null
R8078:Cspg4	UTSW	9	56890259	missense	possibly damaging	0.57
R8082:Cspg4	UTSW	9	56885893	missense	probably damaging	1.00
R8217:Cspg4	UTSW	9	56890353	missense	possibly damaging	0.53
R8237:Cspg4	UTSW	9	56892680	missense	probably damaging	1.00
R8353:Cspg4	UTSW	9	56898669	missense	probably damaging	1.00
R8372:Cspg4	UTSW	9	56887195	missense	probably damaging	1.00
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTGTCATCACTGTGAGGGACG -3'
(R):5'- AGGTACGTCCTAGAGCTTGG -3'

Sequencing Primer
(F):5'- TCATCACTGTGAGGGACGTGAATG -3'
(R):5'- TCCTAGAGCTTGGGGCAC -3'

Posted On

2015-04-02