Incidental Mutation 'R3830:Gclc'
ID273956
Institutional Source Beutler Lab
Gene Symbol Gclc
Ensembl Gene ENSMUSG00000032350
Gene Nameglutamate-cysteine ligase, catalytic subunit
SynonymsD9Wsu168e, gamma GCS-HS, GLCL-H, Glclc
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location77754535-77794485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77791960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 520 (I520L)
Ref Sequence ENSEMBL: ENSMUSP00000034905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034905]
Predicted Effect probably benign
Transcript: ENSMUST00000034905
AA Change: I520L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034905
Gene: ENSMUSG00000032350
AA Change: I520L

DomainStartEndE-ValueType
Pfam:GCS 236 608 1.3e-185 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase is the first rate-limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. This locus encodes the catalytic subunit, while the regulatory subunit is derived from a different gene located on chromosome 1p22-p21. Mutations at this locus have been associated with hemolytic anemia due to deficiency of gamma-glutamylcysteine synthetase and susceptibility to myocardial infarction.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice are embryonic lethal. One model shows lethality before E13 while another shows lethality between E7.5-E8.5. In this second model, embryos are arrested at the egg cylinder stage, fail to gastrulate, do not form mesoderm, and exhibitincreased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Gclc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gclc APN 9 77792060 missense probably benign
IGL02059:Gclc APN 9 77787816 missense probably damaging 1.00
R0671:Gclc UTSW 9 77786798 missense probably damaging 1.00
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1700:Gclc UTSW 9 77776289 missense probably benign 0.04
R3120:Gclc UTSW 9 77781270 missense possibly damaging 0.84
R6747:Gclc UTSW 9 77788245 missense probably damaging 0.96
R7028:Gclc UTSW 9 77788216 missense probably damaging 1.00
R7120:Gclc UTSW 9 77786750 missense probably damaging 1.00
R7242:Gclc UTSW 9 77785371 missense probably benign 0.00
R7329:Gclc UTSW 9 77776191 missense probably damaging 1.00
R7716:Gclc UTSW 9 77754927 missense probably damaging 1.00
X0021:Gclc UTSW 9 77788209 missense probably damaging 1.00
Z1088:Gclc UTSW 9 77781367 splice site probably null
Z1177:Gclc UTSW 9 77786739 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGCAAAGGTATCACGTGTTGG -3'
(R):5'- GCAACTCTACTGTACCAGATGC -3'

Sequencing Primer
(F):5'- CAAAGGTATCACGTGTTGGGGATC -3'
(R):5'- TTCAGAATACTGCATCGGGTGTCC -3'
Posted On2015-04-02