Incidental Mutation 'R3830:Plekhg1'
ID273957
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 1
SynonymsD10Ertd733e
Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location3740364-3967303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3873400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000114056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
Predicted Effect probably damaging
Transcript: ENSMUST00000042438
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: T123A

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117631
Predicted Effect probably damaging
Transcript: ENSMUST00000120274
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: T123A

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136671
AA Change: T178A
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: T178A

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144543
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3963631 missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3956751 missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3873400 missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3945904 missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3945916 missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3964106 missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3958103 missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3957139 missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3957069 nonsense probably null
IGL02730:Plekhg1 APN 10 3873242 missense possibly damaging 0.59
PIT4453001:Plekhg1 UTSW 10 3963469 missense
R0041:Plekhg1 UTSW 10 3964076 nonsense probably null
R0041:Plekhg1 UTSW 10 3964074 missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3940502 missense probably damaging 0.99
R0068:Plekhg1 UTSW 10 3940504 nonsense probably null
R0333:Plekhg1 UTSW 10 3964419 missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3964235 missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3937971 missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3937853 missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3940538 splice site probably benign
R1501:Plekhg1 UTSW 10 3957361 missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3940526 missense probably damaging 1.00
R1801:Plekhg1 UTSW 10 3963904 missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3903658 critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3945917 missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3958181 missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3963564 missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R4058:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3956985 missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3873127 missense probably benign 0.00
R4772:Plekhg1 UTSW 10 3873130 missense probably damaging 1.00
R4803:Plekhg1 UTSW 10 3957186 missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3903649 missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3965516 unclassified probably benign
R5283:Plekhg1 UTSW 10 3956654 missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3937914 missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3964369 missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3964153 missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3957373 missense probably benign
R6930:Plekhg1 UTSW 10 3963770 missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3940251 missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3956810 missense
R7223:Plekhg1 UTSW 10 3873343 missense
R7353:Plekhg1 UTSW 10 3964327 missense
R7488:Plekhg1 UTSW 10 3957491 missense
R7554:Plekhg1 UTSW 10 3963647 missense
R8014:Plekhg1 UTSW 10 3957758 missense
Predicted Primers PCR Primer
(F):5'- GGTACCAGCACGACCATTTTC -3'
(R):5'- GCGACAGCATTAGGTTTCTCTTC -3'

Sequencing Primer
(F):5'- CGACCATTTTCCAGCAGCG -3'
(R):5'- GACAGCATTAGGTTTCTCTTCATTTG -3'
Posted On2015-04-02