Incidental Mutation 'R3830:Olfr222'
ID273958
Institutional Source Beutler Lab
Gene Symbol Olfr222
Ensembl Gene ENSMUSG00000059610
Gene Nameolfactory receptor 222
SynonymsMOR256-45P, GA_x6K02SYYHDF-1415-2371
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59570255-59576235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59571601 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 46 (N46K)
Ref Sequence ENSEMBL: ENSMUSP00000149533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071943] [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000214351] [ENSMUST00000215339]
Predicted Effect probably damaging
Transcript: ENSMUST00000071943
AA Change: N46K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071835
Gene: ENSMUSG00000059610
AA Change: N46K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 29 311 4.3e-9 PFAM
Pfam:7tm_4 35 312 3.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079476
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214351
AA Change: N46K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215339
AA Change: N46K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Olfr222
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0140:Olfr222 UTSW 11 59570978 missense probably damaging 1.00
R3743:Olfr222 UTSW 11 59571509 missense probably damaging 1.00
R5593:Olfr222 UTSW 11 59571048 missense possibly damaging 0.62
R6538:Olfr222 UTSW 11 59571585 missense probably benign 0.25
R6641:Olfr222 UTSW 11 59570840 missense possibly damaging 0.62
R7074:Olfr222 UTSW 11 59571009 missense probably damaging 1.00
X0028:Olfr222 UTSW 11 59571518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTGGAAAATGGCGTATTG -3'
(R):5'- AATGACTCATTTCATCCCGTGC -3'

Sequencing Primer
(F):5'- TTGAACAGCATCTGAGGG -3'
(R):5'- AAACTCTCTTCACTCATCATCGCAG -3'
Posted On2015-04-02