Incidental Mutation 'R3830:Ntn1'
ID273959
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 68385793 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 110 (D110H)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135141
AA Change: D110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: D110H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.9089 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGTTGTACATTTTGCGGC -3'
(R):5'- ACTTTGTCAACGCGGCCTTC -3'

Sequencing Primer
(F):5'- ACATTTTGCGGCACTGCG -3'
(R):5'- TTCGGCAAGGACGTGCG -3'
Posted On2015-04-02