Incidental Mutation 'R3830:Zfp729a'
ID273964
Institutional Source Beutler Lab
Gene Symbol Zfp729a
Ensembl Gene ENSMUSG00000021510
Gene Namezinc finger protein 729a
SynonymsA530054K11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67612763-67637791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67619878 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 744 (F744Y)
Ref Sequence ENSEMBL: ENSMUSP00000012314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012314] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably damaging
Transcript: ENSMUST00000012314
AA Change: F744Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012314
Gene: ENSMUSG00000021510
AA Change: F744Y

DomainStartEndE-ValueType
KRAB 15 75 6.23e-34 SMART
ZnF_C2H2 91 111 1.91e1 SMART
ZnF_C2H2 147 169 8.34e-3 SMART
PHD 148 209 9.1e0 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 4.47e-3 SMART
PHD 232 293 1.11e1 SMART
RING 233 292 9.27e0 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
PHD 316 377 1.35e1 SMART
ZnF_C2H2 343 365 2.57e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
Pfam:zf-C2HC_2 402 422 7.7e-4 PFAM
ZnF_C2H2 427 449 1.67e-2 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
PHD 456 517 5.33e0 SMART
RING 457 516 9.02e0 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
PHD 540 601 1.46e1 SMART
ZnF_C2H2 567 589 3.58e-2 SMART
ZnF_C2H2 595 617 8.34e-3 SMART
ZnF_C2H2 651 673 4.11e-2 SMART
PHD 652 713 4.64e0 SMART
RING 653 712 6.37e0 SMART
ZnF_C2H2 679 701 2.4e-3 SMART
ZnF_C2H2 707 729 1.03e-2 SMART
ZnF_C2H2 735 757 1.47e-3 SMART
PHD 736 797 5.44e0 SMART
RING 737 796 5.88e0 SMART
ZnF_C2H2 763 785 6.67e-2 SMART
ZnF_C2H2 791 813 2.36e-2 SMART
ZnF_C2H2 819 841 6.32e-3 SMART
ZnF_C2H2 847 869 1.26e-2 SMART
ZnF_C2H2 875 897 6.78e-3 SMART
PHD 876 937 4.55e0 SMART
ZnF_C2H2 903 925 9.58e-3 SMART
ZnF_C2H2 931 953 9.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224548
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225608
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Zfp729a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zfp729a APN 13 67619321 missense probably benign 0.01
IGL01956:Zfp729a APN 13 67621686 missense probably damaging 1.00
IGL02852:Zfp729a APN 13 67619951 missense possibly damaging 0.69
IGL03130:Zfp729a APN 13 67619642 intron probably null
adalet UTSW 13 67619507 missense probably benign 0.00
R0329:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0330:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0383:Zfp729a UTSW 13 67621673 missense possibly damaging 0.83
R0545:Zfp729a UTSW 13 67620226 missense probably benign 0.09
R1013:Zfp729a UTSW 13 67619507 missense probably benign 0.00
R1079:Zfp729a UTSW 13 67619675 missense possibly damaging 0.71
R1255:Zfp729a UTSW 13 67621846 missense probably benign 0.03
R1525:Zfp729a UTSW 13 67619321 missense probably benign 0.01
R1768:Zfp729a UTSW 13 67619251 missense probably benign 0.00
R1926:Zfp729a UTSW 13 67619557 missense probably benign 0.29
R2043:Zfp729a UTSW 13 67621172 missense probably damaging 1.00
R2118:Zfp729a UTSW 13 67621494 intron probably null
R3820:Zfp729a UTSW 13 67621319 missense probably damaging 1.00
R3926:Zfp729a UTSW 13 67620191 nonsense probably null
R4134:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4135:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4670:Zfp729a UTSW 13 67621415 nonsense probably null
R4793:Zfp729a UTSW 13 67620427 missense probably damaging 1.00
R5009:Zfp729a UTSW 13 67620246 missense probably benign 0.01
R5125:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5178:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5438:Zfp729a UTSW 13 67619586 missense possibly damaging 0.94
R6540:Zfp729a UTSW 13 67619648 missense possibly damaging 0.81
R6731:Zfp729a UTSW 13 67620146 missense probably benign 0.09
R6987:Zfp729a UTSW 13 67619939 nonsense probably null
R7001:Zfp729a UTSW 13 67620349 missense probably benign 0.31
R7626:Zfp729a UTSW 13 67620318 nonsense probably null
R7706:Zfp729a UTSW 13 67623493 missense possibly damaging 0.72
X0010:Zfp729a UTSW 13 67621782 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACTTGTACGGATTCTCTCCTGT -3'
(R):5'- CCCTACAAGTGTGAAGATTGTGG -3'

Sequencing Primer
(F):5'- GCCACATATATCACACTTGTGGGG -3'
(R):5'- GGCAAGGCCTTCCATTATCC -3'
Posted On2015-04-02