Incidental Mutation 'R3830:Six2'
ID273968
Institutional Source Beutler Lab
Gene Symbol Six2
Ensembl Gene ENSMUSG00000024134
Gene Namesine oculis-related homeobox 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location85684277-85688274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85685187 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 296 (S296Y)
Ref Sequence ENSEMBL: ENSMUSP00000125871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024947] [ENSMUST00000163568]
Predicted Effect probably damaging
Transcript: ENSMUST00000024947
AA Change: S296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024947
Gene: ENSMUSG00000024134
AA Change: S296Y

DomainStartEndE-ValueType
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163568
AA Change: S296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125871
Gene: ENSMUSG00000024134
AA Change: S296Y

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 1.5e-52 PFAM
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die shortly after birth and exhibit abnormal kidney development. Abnormalities include small kidney, lack of ureteric bud branches throughout the kidney, increased apoptosis and premature and arrested nephron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Six2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Six2 APN 17 85687891 missense probably damaging 1.00
IGL02452:Six2 APN 17 85685378 missense possibly damaging 0.91
IGL02468:Six2 APN 17 85685503 missense possibly damaging 0.80
PIT4449001:Six2 UTSW 17 85685478 missense probably benign 0.00
PIT4812001:Six2 UTSW 17 85685301 missense possibly damaging 0.92
R2073:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2075:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2915:Six2 UTSW 17 85685188 missense probably damaging 1.00
R5834:Six2 UTSW 17 85687664 missense probably damaging 0.96
R7555:Six2 UTSW 17 85687707 missense probably damaging 1.00
R7723:Six2 UTSW 17 85687675 missense probably benign 0.06
R8011:Six2 UTSW 17 85687672 missense probably damaging 1.00
Z1176:Six2 UTSW 17 85685456 missense probably benign 0.26
Z1177:Six2 UTSW 17 85687625 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTCCAAAGGATCTCAAAAG -3'
(R):5'- TAGGCAGTTCCGAGGATGAG -3'

Sequencing Primer
(F):5'- GCAACTTGTTGAAAATGAATCCCC -3'
(R):5'- AGACCACTCGTCGTCCAGTC -3'
Posted On2015-04-02