Incidental Mutation 'R3830:Capn1'
ID273969
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Namecalpain 1
Synonymsmu-calpin, Capa1, Capa-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5988546-6015825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5994847 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 465 (L465Q)
Ref Sequence ENSEMBL: ENSMUSP00000127498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
Predicted Effect probably damaging
Transcript: ENSMUST00000025891
AA Change: L465Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: L465Q

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164843
AA Change: L465Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: L465Q

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCATCTAGTTCCCTGCAGAG -3'
(R):5'- TGACTTACCAGGGTCTCACAG -3'

Sequencing Primer
(F):5'- ATGGGGGTCTGCTACTCAC -3'
(R):5'- AGGGTCTCACAGGCTGC -3'
Posted On2015-04-02