Incidental Mutation 'R3831:Selp'
ID273971
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Nameselectin, platelet
SynonymsGrmp, CD62P, P-selectin
MMRRC Submission 040777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164115264-164150026 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 164132280 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 368 (C368*)
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
PDB Structure
Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000162746
AA Change: C368*
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580
AA Change: C368*

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Fam92b T A 8: 120,174,894 Y24F probably damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2244:Selp UTSW 1 164137286 nonsense probably null
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4796:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R4921:Selp UTSW 1 164141397 missense possibly damaging 0.93
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5734:Selp UTSW 1 164143891 splice site probably benign
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 intron probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
R7677:Selp UTSW 1 164133956 missense probably damaging 1.00
R7831:Selp UTSW 1 164145015 critical splice donor site probably null
R8196:Selp UTSW 1 164133921 missense possibly damaging 0.82
Z1176:Selp UTSW 1 164126432 missense probably benign 0.00
Z1177:Selp UTSW 1 164144898 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCAGCATCTTCCAGGAGAC -3'
(R):5'- GGATGATCATTGTCTTCATGGTCTATC -3'

Sequencing Primer
(F):5'- AGCATCTTCCAGGAGACTCTTCTAAG -3'
(R):5'- TCTTCATGGTCTATCTATGTTGGAG -3'
Posted On2015-04-02