Incidental Mutation 'R3831:Itpkb'
ID273975
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
MMRRC Submission 040777-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180333695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 462 (V462A)
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050581
SMART Domains Protein: ENSMUSP00000050698
Gene: ENSMUSG00000055676

DomainStartEndE-ValueType
Gp_dh_N 2 154 5.53e-95 SMART
Pfam:Gp_dh_C 159 316 5.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070181
AA Change: V462A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855
AA Change: V462A

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195043
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Fam92b T A 8: 120,174,894 Y24F probably damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Selp T A 1: 164,132,280 C368* probably null Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2474:Itpkb UTSW 1 180334151 missense probably damaging 1.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3967:Itpkb UTSW 1 180327798 unclassified probably benign
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5593:Itpkb UTSW 1 180334096 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5772:Itpkb UTSW 1 180334253 intron probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
R7689:Itpkb UTSW 1 180413979 missense probably damaging 1.00
R7816:Itpkb UTSW 1 180413889 missense probably damaging 1.00
R8001:Itpkb UTSW 1 180332494 missense probably damaging 1.00
R8155:Itpkb UTSW 1 180332348 missense possibly damaging 0.86
RF008:Itpkb UTSW 1 180333322 missense probably damaging 0.99
RF017:Itpkb UTSW 1 180333322 missense probably damaging 0.99
RF018:Itpkb UTSW 1 180333322 missense probably damaging 0.99
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCTGTAGACCTGGATTC -3'
(R):5'- ATCTCTTGGCAGCTAGGGTG -3'

Sequencing Primer
(F):5'- CCTGTAGACCTGGATTCCGTAG -3'
(R):5'- TAGGGTGAGCATCTCCGTC -3'
Posted On2015-04-02