Incidental Mutation 'R3831:Hao1'
ID273980
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission 040777-MU
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134523005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 234 (V234D)
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028704
AA Change: V234D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: V234D

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Meta Mutation Damage Score 0.7201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Fam92b T A 8: 120,174,894 Y24F probably damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Selp T A 1: 164,132,280 C368* probably null Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3833:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R7920:Hao1 UTSW 2 134548252 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGTCAAGAGGTTTACTAAAAC -3'
(R):5'- AGGTGGCTGAGTACGTTACAG -3'

Sequencing Primer
(F):5'- TATAGTGACTCGCAAGTGCC -3'
(R):5'- TCACCAAGTCAGATATAAACTGTCTC -3'
Posted On2015-04-02