Incidental Mutation 'R3831:Phf14'
ID273991
Institutional Source Beutler Lab
Gene Symbol Phf14
Ensembl Gene ENSMUSG00000029629
Gene NamePHD finger protein 14
Synonyms5730446A07Rik, 4932409F11Rik, 1110001C23Rik
MMRRC Submission 040777-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location11907809-12081205 bp(+) (GRCm38)
Type of Mutationunclassified (464 bp from exon)
DNA Base Change (assembly) A to G at 11933874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511] [ENSMUST00000155037] [ENSMUST00000203459]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090632
AA Change: D245G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115510
AA Change: D245G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115511
AA Change: D245G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
RING 315 381 1.21e1 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
RING 721 769 2.63e0 SMART
low complexity region 830 848 N/A INTRINSIC
PHD 863 912 9.92e-9 SMART
RING 864 911 3.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133776
SMART Domains Protein: ENSMUSP00000115485
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PHD 40 97 1.64e-9 SMART
PHD 159 218 1.18e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155037
SMART Domains Protein: ENSMUSP00000144981
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203459
Meta Mutation Damage Score 0.1670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Fam92b T A 8: 120,174,894 Y24F probably damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Selp T A 1: 164,132,280 C368* probably null Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Phf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Phf14 APN 6 11941424 splice site probably benign
IGL01120:Phf14 APN 6 11962740 missense probably damaging 1.00
IGL01575:Phf14 APN 6 11990051 missense probably damaging 1.00
IGL02153:Phf14 APN 6 11934016 missense probably damaging 0.99
IGL02735:Phf14 APN 6 11987612 missense probably benign 0.21
IGL03294:Phf14 APN 6 11953367 missense probably damaging 1.00
IGL03392:Phf14 APN 6 11962659 missense probably damaging 1.00
R0060:Phf14 UTSW 6 11953317 missense probably damaging 0.97
R0099:Phf14 UTSW 6 11987697 unclassified probably benign
R0384:Phf14 UTSW 6 11997020 splice site probably benign
R0433:Phf14 UTSW 6 11933743 missense probably damaging 1.00
R0563:Phf14 UTSW 6 11933601 intron probably benign
R0590:Phf14 UTSW 6 11961578 missense possibly damaging 0.72
R1066:Phf14 UTSW 6 11987255 missense possibly damaging 0.47
R1187:Phf14 UTSW 6 11941496 missense probably damaging 0.97
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1491:Phf14 UTSW 6 11941479 missense possibly damaging 0.80
R1543:Phf14 UTSW 6 11987683 critical splice donor site probably null
R1595:Phf14 UTSW 6 11988753 missense possibly damaging 0.69
R1861:Phf14 UTSW 6 11987611 missense probably benign 0.00
R2289:Phf14 UTSW 6 12047846 missense probably damaging 1.00
R2437:Phf14 UTSW 6 11962658 missense probably damaging 1.00
R3832:Phf14 UTSW 6 11933874 unclassified probably null
R3833:Phf14 UTSW 6 11933874 unclassified probably null
R4290:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4293:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4294:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4295:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4572:Phf14 UTSW 6 12006824 missense probably damaging 1.00
R4663:Phf14 UTSW 6 11953422 missense possibly damaging 0.92
R4673:Phf14 UTSW 6 11992057 missense probably damaging 1.00
R4882:Phf14 UTSW 6 11988757 missense possibly damaging 0.88
R4954:Phf14 UTSW 6 11987620 missense probably benign 0.09
R5148:Phf14 UTSW 6 11961642 missense possibly damaging 0.72
R5284:Phf14 UTSW 6 11997120 missense probably damaging 0.99
R5569:Phf14 UTSW 6 11934016 missense probably damaging 0.99
R5694:Phf14 UTSW 6 11990125 missense possibly damaging 0.68
R5726:Phf14 UTSW 6 11933538 intron probably benign
R5730:Phf14 UTSW 6 11953320 missense possibly damaging 0.54
R5819:Phf14 UTSW 6 11997252 intron probably null
R5915:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R6578:Phf14 UTSW 6 11991997 missense probably damaging 1.00
R6950:Phf14 UTSW 6 12006855 missense probably damaging 1.00
R7181:Phf14 UTSW 6 11933341 missense unknown
R7352:Phf14 UTSW 6 11961638 missense probably damaging 1.00
R7355:Phf14 UTSW 6 12081007 missense probably benign 0.01
R8110:Phf14 UTSW 6 11953423 missense possibly damaging 0.91
R8283:Phf14 UTSW 6 11987637 missense probably benign 0.20
R8301:Phf14 UTSW 6 11992062 missense probably damaging 0.97
X0025:Phf14 UTSW 6 11926813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCGTCGGAACCGTCC -3'
(R):5'- TTAGAAAATTCCCTTTCCCCAGACAG -3'

Sequencing Primer
(F):5'- GTTGGACTTTGTATCCATGGAAGAAC -3'
(R):5'- CAGACAGATATAAAAATTGGGTTGC -3'
Posted On2015-04-02