Mutagenetix > Incidental Mutation

Incidental Mutation 'R3831:Smarca5'

274001

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

040777-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80728494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 199 (N199K)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: N199K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: N199K

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148455

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209804

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,973,708	T527A	unknown	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1c	A	G	6: 118,604,463	S1727P	probably benign	Het
Cacnb2	A	T	2: 14,981,425	I338F	probably damaging	Het
Cyb5d2	G	T	11: 72,795,523	S80R	possibly damaging	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Fam92b	T	A	8: 120,174,894	Y24F	probably damaging	Het
Frmd4b	T	A	6: 97,412,525	K73*	probably null	Het
Hao1	A	T	2: 134,523,005	V234D	probably damaging	Het
Hkdc1	T	C	10: 62,400,212	Y517C	probably benign	Het
Iglv2	A	T	16: 19,260,843	M1K	probably null	Het
Inpp5j	T	C	11: 3,500,229	D228G	probably damaging	Het
Itih5	A	G	2: 10,251,270	D849G	possibly damaging	Het
Itpkb	T	C	1: 180,333,695	V462A	probably benign	Het
Kif26b	GAAA	GAA	1: 178,916,616		probably null	Het
Kremen1	G	GGGC	11: 5,201,794		probably benign	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mageh1	A	T	X: 153,037,008	W111R	probably damaging	Het
Mapk7	A	G	11: 61,489,854	S641P	possibly damaging	Het
Mapt	A	T	11: 104,287,135	Q38L	possibly damaging	Het
Med12	C	A	X: 101,295,892	P2037Q	possibly damaging	Het
Med22	A	G	2: 26,910,367	S17P	probably damaging	Het
Melk	C	A	4: 44,345,021	Q384K	probably benign	Het
Morc2b	C	T	17: 33,137,259	S513N	probably benign	Het
Nap1l3	A	G	X: 122,396,298	V241A	possibly damaging	Het
Olfr311	T	G	11: 58,841,860	F249V	probably damaging	Het
Olfr315	T	A	11: 58,778,745		probably null	Het
Olfr684	A	G	7: 105,157,382	F100S	probably damaging	Het
Pdgfd	T	C	9: 6,359,762	S278P	probably damaging	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Phf14	A	G	6: 11,933,874		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Rgs5	A	G	1: 169,676,901	Y40C	probably benign	Het
Rsad1	A	G	11: 94,543,304	V366A	probably benign	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scarf1	T	C	11: 75,515,252	C121R	probably damaging	Het
Scn7a	A	G	2: 66,697,684	S821P	probably damaging	Het
Sco1	T	C	11: 67,053,779	V76A	probably damaging	Het
Selp	T	A	1: 164,132,280	C368*	probably null	Het
Sema3e	T	A	5: 14,226,482	C294S	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sorbs2	A	T	8: 45,795,095	D442V	probably damaging	Het
Specc1	T	A	11: 62,117,967	I183N	probably damaging	Het
Tcerg1	G	T	18: 42,568,489	R872L	probably damaging	Het
Tekt1	T	C	11: 72,354,819	N170S	probably benign	Het
Thsd1	T	G	8: 22,243,116	S60A	possibly damaging	Het
Tmem2	T	G	19: 21,847,951	S1204R	probably damaging	Het
Usp24	T	C	4: 106,362,012		probably null	Het
Usp28	A	G	9: 49,035,638	T505A	probably benign	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zranb1	C	T	7: 132,982,776	A591V	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACAACTAAGGCAGTGGG -3'
(R):5'- TGCTTCAGTCCAGATTTCATTAGC -3'

Sequencing Primer
(F):5'- CAACTAAGGCAGTGGGTTATAGTGC -3'
(R):5'- CATGTAAGGTTACACATGTATCCTC -3'

Posted On

2015-04-02