Incidental Mutation 'R3831:Fam92b'
ID274002
Institutional Source Beutler Lab
Gene Symbol Fam92b
Ensembl Gene ENSMUSG00000042269
Gene Namefamily with sequence similarity 92, member B
Synonyms
MMRRC Submission 040777-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120166397-120177466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120174894 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 24 (Y24F)
Ref Sequence ENSEMBL: ENSMUSP00000038825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048786] [ENSMUST00000127664] [ENSMUST00000135567]
Predicted Effect probably damaging
Transcript: ENSMUST00000048786
AA Change: Y24F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038825
Gene: ENSMUSG00000042269
AA Change: Y24F

DomainStartEndE-ValueType
Pfam:FAM92 1 217 4.8e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135567
AA Change: Y24F

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134033
Gene: ENSMUSG00000042269
AA Change: Y24F

DomainStartEndE-ValueType
Pfam:FAM92 1 95 2e-21 PFAM
low complexity region 98 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153177
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Selp T A 1: 164,132,280 C368* probably null Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Fam92b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Fam92b APN 8 120166690 missense probably benign 0.00
IGL02045:Fam92b APN 8 120169722 nonsense probably null
IGL02437:Fam92b APN 8 120174786 missense probably damaging 1.00
IGL02796:Fam92b UTSW 8 120177399 utr 5 prime probably benign
R1061:Fam92b UTSW 8 120169704 critical splice donor site probably null
R2285:Fam92b UTSW 8 120168537 missense probably benign 0.01
R3714:Fam92b UTSW 8 120174837 missense probably damaging 1.00
R4432:Fam92b UTSW 8 120174855 missense probably damaging 1.00
R5431:Fam92b UTSW 8 120167303 critical splice donor site probably null
R6280:Fam92b UTSW 8 120172119 missense possibly damaging 0.75
R7026:Fam92b UTSW 8 120168585 missense probably damaging 1.00
R7233:Fam92b UTSW 8 120171922 missense probably damaging 1.00
R7278:Fam92b UTSW 8 120168603 missense possibly damaging 0.63
R7334:Fam92b UTSW 8 120174850 missense probably damaging 0.99
R7840:Fam92b UTSW 8 120166633 missense probably benign 0.32
R7923:Fam92b UTSW 8 120166633 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCCTGCACTTTGGCAAGGTC -3'
(R):5'- TGCTTGGATGGATTCAAGGC -3'

Sequencing Primer
(F):5'- ACTTTGGCAAGGTCCTCGG -3'
(R):5'- CTTGGATGGATTCAAGGCATGCC -3'
Posted On2015-04-02