Incidental Mutation 'R3831:Zfp445'
ID274006
Institutional Source Beutler Lab
Gene Symbol Zfp445
Ensembl Gene ENSMUSG00000047036
Gene Namezinc finger protein 445
SynonymsZNF168
MMRRC Submission 040777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R3831 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122844529-122866006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122852476 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 800 (E800A)
Ref Sequence ENSEMBL: ENSMUSP00000151198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056467] [ENSMUST00000213971] [ENSMUST00000214626] [ENSMUST00000216063]
Predicted Effect probably damaging
Transcript: ENSMUST00000056467
AA Change: E800A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055738
Gene: ENSMUSG00000047036
AA Change: E800A

DomainStartEndE-ValueType
SCAN 48 160 1.07e-59 SMART
KRAB 219 278 6.74e-30 SMART
low complexity region 320 334 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
ZnF_C2H2 470 492 2.09e-3 SMART
ZnF_C2H2 498 520 3.16e-3 SMART
ZnF_C2H2 553 575 1.41e0 SMART
ZnF_C2H2 581 603 1.04e-3 SMART
ZnF_C2H2 634 656 1.6e-4 SMART
ZnF_C2H2 662 686 6.78e-3 SMART
ZnF_C2H2 718 740 1.67e-2 SMART
ZnF_C2H2 746 768 1.2e-3 SMART
ZnF_C2H2 796 818 2.02e-1 SMART
ZnF_C2H2 824 846 2.95e-3 SMART
ZnF_C2H2 933 955 2.49e-1 SMART
ZnF_C2H2 961 983 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213573
Predicted Effect probably benign
Transcript: ENSMUST00000213971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214162
Predicted Effect probably benign
Transcript: ENSMUST00000214626
Predicted Effect probably damaging
Transcript: ENSMUST00000216063
AA Change: E800A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216243
Meta Mutation Damage Score 0.3735 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,708 T527A unknown Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1c A G 6: 118,604,463 S1727P probably benign Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Fam92b T A 8: 120,174,894 Y24F probably damaging Het
Frmd4b T A 6: 97,412,525 K73* probably null Het
Hao1 A T 2: 134,523,005 V234D probably damaging Het
Hkdc1 T C 10: 62,400,212 Y517C probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Inpp5j T C 11: 3,500,229 D228G probably damaging Het
Itih5 A G 2: 10,251,270 D849G possibly damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Kremen1 G GGGC 11: 5,201,794 probably benign Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Melk C A 4: 44,345,021 Q384K probably benign Het
Morc2b C T 17: 33,137,259 S513N probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Olfr311 T G 11: 58,841,860 F249V probably damaging Het
Olfr315 T A 11: 58,778,745 probably null Het
Olfr684 A G 7: 105,157,382 F100S probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Rgs5 A G 1: 169,676,901 Y40C probably benign Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Selp T A 1: 164,132,280 C368* probably null Het
Sema3e T A 5: 14,226,482 C294S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Smarca5 A T 8: 80,728,494 N199K probably damaging Het
Sorbs2 A T 8: 45,795,095 D442V probably damaging Het
Specc1 T A 11: 62,117,967 I183N probably damaging Het
Tcerg1 G T 18: 42,568,489 R872L probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem2 T G 19: 21,847,951 S1204R probably damaging Het
Usp24 T C 4: 106,362,012 probably null Het
Usp28 A G 9: 49,035,638 T505A probably benign Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zranb1 C T 7: 132,982,776 A591V probably damaging Het
Other mutations in Zfp445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Zfp445 APN 9 122852230 missense probably benign 0.02
IGL02608:Zfp445 APN 9 122861875 missense probably damaging 0.98
IGL03216:Zfp445 APN 9 122851978 missense probably damaging 0.99
IGL03218:Zfp445 APN 9 122857529 missense probably benign 0.00
Nonpareil UTSW 9 122852345 missense probably benign 0.02
R0080:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0082:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0453:Zfp445 UTSW 9 122853513 missense possibly damaging 0.92
R0610:Zfp445 UTSW 9 122852981 missense probably benign 0.44
R0730:Zfp445 UTSW 9 122861758 missense probably damaging 1.00
R1622:Zfp445 UTSW 9 122852549 missense possibly damaging 0.90
R1719:Zfp445 UTSW 9 122852642 missense probably damaging 1.00
R2108:Zfp445 UTSW 9 122852240 missense probably benign 0.13
R2117:Zfp445 UTSW 9 122853437 nonsense probably null
R2143:Zfp445 UTSW 9 122853482 missense possibly damaging 0.70
R2162:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R3620:Zfp445 UTSW 9 122852768 missense probably benign
R3621:Zfp445 UTSW 9 122852768 missense probably benign
R3745:Zfp445 UTSW 9 122854726 missense probably benign 0.00
R3829:Zfp445 UTSW 9 122853077 missense probably benign
R4172:Zfp445 UTSW 9 122851937 missense probably benign 0.01
R4180:Zfp445 UTSW 9 122852524 missense probably benign 0.00
R4747:Zfp445 UTSW 9 122857150 missense possibly damaging 0.81
R4923:Zfp445 UTSW 9 122852293 missense probably benign
R5010:Zfp445 UTSW 9 122852345 missense probably benign 0.02
R5578:Zfp445 UTSW 9 122853337 missense probably benign 0.00
R5759:Zfp445 UTSW 9 122853146 missense probably benign 0.00
R5864:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5865:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5987:Zfp445 UTSW 9 122853886 missense probably benign
R6481:Zfp445 UTSW 9 122857566 missense probably benign 0.00
R6738:Zfp445 UTSW 9 122862058 missense probably damaging 0.96
R6917:Zfp445 UTSW 9 122862294 intron probably null
R7137:Zfp445 UTSW 9 122854778 missense probably damaging 1.00
R7224:Zfp445 UTSW 9 122852143 missense probably benign 0.28
R8056:Zfp445 UTSW 9 122851967 missense possibly damaging 0.95
R8263:Zfp445 UTSW 9 122852813 missense probably benign 0.00
R8313:Zfp445 UTSW 9 122853630 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTTTATCACGCCACTGTGG -3'
(R):5'- GCAAAGCCTTTCACAATCGCTC -3'

Sequencing Primer
(F):5'- ACGCCACTGTGGTTGCTC -3'
(R):5'- CATTCATGAGAGAGTTCACACTAGAG -3'
Posted On2015-04-02