Incidental Mutation 'R3832:Ccdc3'
ID274039
Institutional Source Beutler Lab
Gene Symbol Ccdc3
Ensembl Gene ENSMUSG00000026676
Gene Namecoiled-coil domain containing 3
Synonyms
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5137776-5230878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5229142 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 259 (N259S)
Ref Sequence ENSEMBL: ENSMUSP00000027988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027988]
Predicted Effect probably benign
Transcript: ENSMUST00000027988
AA Change: N259S

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027988
Gene: ENSMUSG00000026676
AA Change: N259S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 188 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180479
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Aging mice homozygous for a null allele are lean and show decreased epididymal and subcutaneous adipose tissue weight and adipocyte size, mild hyperglycemia, increased insulin sensitivity, reduced liver triglyceride levels and steatosis, and fewer inflammatory cells in epididymal fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Ccdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Ccdc3 UTSW 2 5138205 missense probably damaging 1.00
R1164:Ccdc3 UTSW 2 5141266 missense possibly damaging 0.95
R1808:Ccdc3 UTSW 2 5138085 missense probably damaging 1.00
R5686:Ccdc3 UTSW 2 5138060 missense probably damaging 1.00
R5878:Ccdc3 UTSW 2 5229016 missense probably benign 0.27
R6003:Ccdc3 UTSW 2 5141407 critical splice donor site probably null
R6053:Ccdc3 UTSW 2 5229027 missense probably benign 0.22
R6987:Ccdc3 UTSW 2 5138304 missense possibly damaging 0.76
R7470:Ccdc3 UTSW 2 5138304 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGTCAAGAAGCTGCAGCAG -3'
(R):5'- AGTAAGGCCAGGACCCAATG -3'

Sequencing Primer
(F):5'- TGCAGCAGAAGGTGGCC -3'
(R):5'- CTGACAATTTACCCAGTTAGACTC -3'
Posted On2015-04-02