Incidental Mutation 'R3832:Cyp27b1'
ID274069
Institutional Source Beutler Lab
Gene Symbol Cyp27b1
Ensembl Gene ENSMUSG00000006724
Gene Namecytochrome P450, family 27, subfamily b, polypeptide 1
SynonymsCyp27b, Vdd1, 25(OH)D 1alpha-hydroxylase, 1alpha(OH)ase, P450VD1alpha, 25-hydroxyvitamin D3 1alpha-hydroxylase, Cyp40, Cp2b, Cyp1, VddrI, Pddr, P450c1, Vddr
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127048250-127053006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127051060 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 382 (V382L)
Ref Sequence ENSEMBL: ENSMUSP00000130005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006915] [ENSMUST00000040307] [ENSMUST00000165764] [ENSMUST00000172069]
Predicted Effect probably benign
Transcript: ENSMUST00000006915
SMART Domains Protein: ENSMUSP00000006915
Gene: ENSMUSG00000006732

DomainStartEndE-ValueType
Pfam:Methyltransf_4 70 248 3.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040307
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165764
AA Change: V382L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130005
Gene: ENSMUSG00000006724
AA Change: V382L

DomainStartEndE-ValueType
Pfam:p450 40 504 7.1e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171868
Predicted Effect probably benign
Transcript: ENSMUST00000172069
Meta Mutation Damage Score 0.6020 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the inner mitochondrial membrane where it hydroxylates 25-hydroxyvitamin D3 at the 1alpha position. This reaction synthesizes 1alpha,25-dihydroxyvitamin D3, the active form of vitamin D3, which binds to the vitamin D receptor and regulates calcium metabolism. Thus this enzyme regulates the level of biologically active vitamin D and plays an important role in calcium homeostasis. Mutations in this gene can result in vitamin D-dependent rickets type I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit hypocalcemia, hyperparathyroidism, retarded growth, enlarged lymph nodes, and rickets. Females have uterine hypoplasia and lack corpora lutea, resulting in infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Cyp27b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyp27b1 APN 10 127049682 missense probably benign 0.19
IGL01147:Cyp27b1 APN 10 127050386 missense possibly damaging 0.94
IGL02370:Cyp27b1 APN 10 127050674 splice site probably benign
IGL02670:Cyp27b1 APN 10 127050358 missense probably benign 0.01
IGL02671:Cyp27b1 APN 10 127051043 unclassified probably null
R0483:Cyp27b1 UTSW 10 127050157 missense probably benign 0.02
R0517:Cyp27b1 UTSW 10 127050116 unclassified probably null
R0645:Cyp27b1 UTSW 10 127049098 missense probably benign 0.02
R1479:Cyp27b1 UTSW 10 127051711 critical splice donor site probably null
R1491:Cyp27b1 UTSW 10 127051088 missense probably damaging 0.98
R1830:Cyp27b1 UTSW 10 127049083 missense possibly damaging 0.92
R1929:Cyp27b1 UTSW 10 127048312 missense probably damaging 1.00
R2162:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R2281:Cyp27b1 UTSW 10 127048294 missense probably damaging 0.99
R2291:Cyp27b1 UTSW 10 127048294 missense possibly damaging 0.80
R3831:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R3833:Cyp27b1 UTSW 10 127051060 missense probably damaging 1.00
R4306:Cyp27b1 UTSW 10 127051088 missense probably benign 0.21
R5213:Cyp27b1 UTSW 10 127052095 missense probably damaging 1.00
R5405:Cyp27b1 UTSW 10 127050386 missense possibly damaging 0.94
R5463:Cyp27b1 UTSW 10 127052097 missense possibly damaging 0.89
R5906:Cyp27b1 UTSW 10 127048398 missense probably damaging 1.00
R6181:Cyp27b1 UTSW 10 127050410 missense probably damaging 1.00
R6515:Cyp27b1 UTSW 10 127048250 start gained probably benign
R7249:Cyp27b1 UTSW 10 127051049 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCCTGTTAAAGGCTGTG -3'
(R):5'- CCAGTTTAAAAGTGGGCCTTG -3'

Sequencing Primer
(F):5'- CCCCTGTTAAAGGCTGTGATCAAAG -3'
(R):5'- CCTCTACTACTCCCATTATGCTGG -3'
Posted On2015-04-02