Incidental Mutation 'R3832:Sco1'
ID274073
Institutional Source Beutler Lab
Gene Symbol Sco1
Ensembl Gene ENSMUSG00000069844
Gene NameSCO1 cytochrome c oxidase assembly protein
SynonymsD11Bwg1310e, 2610001C07Rik
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67052670-67067070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67053779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000104330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092996] [ENSMUST00000108690] [ENSMUST00000116363] [ENSMUST00000146338]
Predicted Effect probably damaging
Transcript: ENSMUST00000092996
AA Change: V76A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090673
Gene: ENSMUSG00000069844
AA Change: V76A

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 81 265 1.5e-48 PFAM
Pfam:AhpC-TSA 118 250 9.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108690
AA Change: V76A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104330
Gene: ENSMUSG00000069844
AA Change: V76A

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:SCO1-SenC 91 270 2.4e-49 PFAM
Pfam:AhpC-TSA 125 254 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116363
SMART Domains Protein: ENSMUSP00000112064
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
Pfam:Metallophos 18 282 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137779
Predicted Effect probably benign
Transcript: ENSMUST00000146338
SMART Domains Protein: ENSMUSP00000137768
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
PDB:2NXF|A 13 199 4e-47 PDB
SCOP:d1utea_ 15 176 3e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148379
Meta Mutation Damage Score 0.1865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian cytochrome c oxidase (COX) catalyzes the transfer of reducing equivalents from cytochrome c to molecular oxygen and pumps protons across the inner mitochondrial membrane. In yeast, 2 related COX assembly genes, SCO1 and SCO2 (synthesis of cytochrome c oxidase), enable subunits 1 and 2 to be incorporated into the holoprotein. This gene is the human homolog to the yeast SCO1 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver exhibit weight loss, premature death, spleen atrophy, reduced white blood cells, increased mitochondria proliferation, increased iron levels in the liver and spleen, and decreased copper levels in the liver and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Sco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Sco1 APN 11 67064038 makesense probably null
IGL01765:Sco1 APN 11 67053790 missense probably damaging 1.00
IGL03103:Sco1 APN 11 67055742 nonsense probably null
R2929:Sco1 UTSW 11 67063922 missense probably damaging 1.00
R3831:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R3833:Sco1 UTSW 11 67053779 missense probably damaging 0.99
R4019:Sco1 UTSW 11 67064020 missense probably benign
R4020:Sco1 UTSW 11 67064020 missense probably benign
R4299:Sco1 UTSW 11 67055800 missense possibly damaging 0.84
R4541:Sco1 UTSW 11 67052842 missense probably benign 0.00
R4715:Sco1 UTSW 11 67056599 missense probably damaging 1.00
R5411:Sco1 UTSW 11 67063958 missense probably damaging 1.00
R6344:Sco1 UTSW 11 67055745 missense probably damaging 1.00
R7026:Sco1 UTSW 11 67053857 missense probably damaging 1.00
R7798:Sco1 UTSW 11 67053802 missense possibly damaging 0.67
R7819:Sco1 UTSW 11 67058393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTGCAGTAGATTATAGCCATTAC -3'
(R):5'- TGCCCTCTGACCTGGAAAAC -3'

Sequencing Primer
(F):5'- GCCATTACTTATCCCCAAATAACCTG -3'
(R):5'- GGGGTAACCACTTACTTTCT -3'
Posted On2015-04-02