Incidental Mutation 'R3832:Scarf1'
ID274076
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Namescavenger receptor class F, member 1
SynonymsSREC-I, SREC
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75513540-75526582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75515252 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 121 (C121R)
Ref Sequence ENSEMBL: ENSMUSP00000114090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000118243] [ENSMUST00000123819]
Predicted Effect probably damaging
Transcript: ENSMUST00000042808
AA Change: C121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188
AA Change: C121R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118243
AA Change: C121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188
AA Change: C121R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156923
Meta Mutation Damage Score 0.784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75521957 missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75524089 missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75515162 splice site probably benign
R0606:Scarf1 UTSW 11 75514348 missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75514403 nonsense probably null
R1715:Scarf1 UTSW 11 75524044 missense probably damaging 1.00
R2327:Scarf1 UTSW 11 75526028 missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75515291 missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75514369 missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75515252 missense probably damaging 1.00
R4957:Scarf1 UTSW 11 75525634 missense probably benign 0.10
R4990:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R4992:Scarf1 UTSW 11 75522230 missense probably damaging 1.00
R4992:Scarf1 UTSW 11 75526015 missense probably benign 0.00
R5291:Scarf1 UTSW 11 75524074 missense probably damaging 1.00
R5330:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75515580 missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75525531 missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75514016 missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75525687 missense probably benign 0.08
R6130:Scarf1 UTSW 11 75525739 missense probably benign
R6289:Scarf1 UTSW 11 75525416 missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75520315 missense probably benign 0.02
R6360:Scarf1 UTSW 11 75515669 missense probably damaging 1.00
R6944:Scarf1 UTSW 11 75522206 missense probably benign 0.00
R7113:Scarf1 UTSW 11 75526078 missense probably damaging 0.99
Z1088:Scarf1 UTSW 11 75525490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGTTCTCAGGGTCTGTC -3'
(R):5'- ATACACAGGTTCCAGTGGC -3'

Sequencing Primer
(F):5'- AGGAGCAAGACTGTGTCCTCTTC -3'
(R):5'- AGTGGCCTGGTCACAGC -3'
Posted On2015-04-02